1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
3 years ago
12

If genetic drift is occurring you will be able to predict which allele will become more prevalent.

Biology
1 answer:
Blizzard [7]3 years ago
7 0

Answer:

b. False

Explanation:

Genetic drift corresponds to a drastic casual alteration of the natural order, reaching the genotypic concentration of one or several species, not preliminarily involving natural selection factors, but caused by sudden events. As happens at random, it is impossible to predict which allele will be prevalent in a population suffering from genetic drift.

Such phenomenon is characterized by the occurrence of ecological catastrophes, for example: earthquakes, tsunamis, tornadoes, floods, burnings, avalanches and other processes, affecting a large population contingent.

Thus limiting the genetic content of a particular group, restricted to the prevailing individuals. It is up to them, integration into another population, if an adaptation is maintained, or over time, from geographic and later reproductive isolation, constitution of a new species (principle of the founding species).

In this situation, with low variability, differentiated individuals will experience a more significant selection pressure in relation to the ascending lineage, which minimized the achievements of selection due to the high number of living individuals.

During evolution, a hypothesis concerning the decimation of dinosaurs, which occurred around 66 million years ago, establishes not only the end of these animals, but of various life forms (including plants), due to a huge asteroid that would have reached planet, raising a dense cloud of dust resulting from the collision, compromising photosynthetic processes (dependent on solar energy), as well as the respiration and nutrition of organisms.

You might be interested in
______________ these compounds regulate cell division rates, maintain normal kidney function and fluid balance, direct hormones
Alik [6]

<u>Full question</u>:

___________ these compounds regulate cell division rates, maintain normal kidney functions, and fluid balance, direct hormones to their target cells, regulate the flow of substances in an out of cells and regulate ovulation.

a- triglycerides

b- amino acids

c- eicosanoids

d- carbohydrates

<u>Answer:</u>

Eicosanoids these compounds regulate cell division rates, maintain normal kidney functions, and fluid balance, direct hormones to their target cells, regulate the flow of substances in an out of cells and regulate ovulation.

<u>Explanation:</u>

Eicosanoids behave like hormones, but they did not desire to move. Eicosanoids sometimes seem on cells nearby to their locality of composition. Eicosanoids also swiftly split down, so they are incapable of progress quite notably. Most eicosanoids are created from arachidonic acid.

Hen, eggs, burgers are samples of meals that render arachidonic acid. The eicosanoids obtained from certain fatty acids possess a diversity of consequences on your body. They also modify the insusceptible rejoinder and several respiratory and generative processes.

5 0
3 years ago
Select the correct days. rachel and her team will conduct canopy fogging to monitor the insect population in an area. looking at
Romashka [77]

Monday is the best day since there is no wind. To conduct canopy fogging, the ideal conditions would be windless and calm, so as not to disrupt the fogging operation.

<h3>What is canopy fogging?</h3>

During fogging, a petrol-powered fogging machine is used to disseminate a non-hazardous natural pyrethroid pesticide into the forest canopy.

The missing image of the question is attached below.

As per the image description, Monday is the best day since there is no wind. To conduct canopy fogging, the ideal conditions would be windless and calm, so as not to disrupt the fogging operation.

Thus, Rachel should conduct canopy fogging on Monday according to the given scenario.

For more details regarding canopy fogging, visit:

brainly.com/question/10435245

#SPJ1

3 0
3 years ago
What is the difference between bioaccumulation and biomagnification?
Schach [20]
Bioaccumulation refers to the accumulation of a toxic chemical in the tissue of a particular organism.
Biomagnification refers to the increased concentration of a toxic chemical the higher an animal is on the food chain.
3 0
3 years ago
Which statement can best be supported by the picture of embryos
erastovalidia [21]
A

Explanation:
it’s the one that makes the most sense !
4 0
2 years ago
Fill in the blank: _______ is the written safety and health measures for hazardous tasks. standard operating procedures chemical
Naya [18.7K]

The standard operating procedure or SOP is a written safety and health measures for hazardous tasks. It is a detailed instructions or step-by-step directions for conducting a specific procedure especially when dealing with chemicals that may cause injury. Moreover, because of these SOP’s accident and untoward circumstances in the workplace can be avoided.

3 0
4 years ago
Other questions:
  • consider The response of a plant cell in a hypotonic solution as seen here. imagine a human red blood cell being placed in the s
    9·1 answer
  • This is formed as a waste product in photosynthesis and used as a reactant in respiration.
    14·1 answer
  • How does the reproductive system maintain homeostasis?
    8·1 answer
  • 5.
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which term describes one kind of movement of Earth? A.)eclipse B.)revolution C.)tilted orbit D.) lunar cycle
    11·1 answer
  • All protists are single-celled True or False
    14·1 answer
  • I need help like asap thank you very much
    7·2 answers
  • Cancer cells are developed through a malfunction within the cell cycle. Which
    15·1 answer
  • Match the perspective in column 1 to the corresponding question in column 2.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!