1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
3 years ago
11

Wind can erode rocks especially in desert areas select all spheres that are interacting in this situation

Biology
2 answers:
WINSTONCH [101]3 years ago
6 0
Hello there.
<span>
Wind can erode rocks especially in desert areas select all spheres that are interacting in this situation
</span>
Erosion
Murrr4er [49]3 years ago
5 0
Erosion is brought about by the forces of nature or human activity: water, wind, earthquakes, mining, quarrying, etc. In the desert, there is very little water that can cause weathering or erosion, so the most probable answer is wind or maybe even animal activity.
You might be interested in
The product of the glycolysis reaction is the molecule called___
Andrej [43]

Answer:

I know it is B

Explanation:

5 0
3 years ago
hey could someone help me with this immediately!! i will mark u brainiest if u don’t guess or leave a link!!!
svp [43]

Answer:

Chemical energy changes into thermal energy and light energy

6 0
3 years ago
Read 2 more answers
How many bacteria can you have in ten hours if you started with one bacteria?
pav-90 [236]
Bacteria can divide every minute, so given 600 minutes in ten hours it would be an extremely large number

8 0
4 years ago
What is the formula for Glucose
Rom4ik [11]

Answer: Glucose also called dextrose one of a group of carbohydrates know as simple sugars.

4 0
3 years ago
Read 2 more answers
using a genetic code chart and the mRNA codons provided in the table below, fill in the appropriate amino acids in the BLANK box
777dan777 [17]

Answer: easy

Explanation:

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Maintenance of a stable body temperature can be achieved through which systems
    11·1 answer
  • (07.06 MC)
    7·1 answer
  • Someone Help me PLEASE.
    12·1 answer
  • Observations of organisms include
    9·2 answers
  • Could you help me pls? 15 points!!!
    13·1 answer
  • A particle can infect humans and make them sick. It attaches to a host cell and injects its RNA, which the host uses to make pro
    9·2 answers
  • Moving a spring toy up and down will create what kind of wave?
    9·2 answers
  • Which particles zoom around the center of atoms?
    10·1 answer
  • How the plantlets are produced?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!