1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krok68 [10]
4 years ago
12

Will give brainliest, a THX, a friend request, and will rate ur answer

Biology
2 answers:
Pachacha [2.7K]4 years ago
8 0

Answer:

The answer is: 3 tennis balls because there will be 4 ping pong balls used for every model and 12/4=3

Explanation:

MrRa [10]4 years ago
6 0

Answer:

Here ya go!

Explanation:

You would need only 2 tennis ball to complete the model. By splitting each tennis ball in half you will now have 4 parts. I have already glued the 12 ping pong ball together in a circular shape. I would then just glue the parts of the tennis balls on the ping pong mass is reference to the picture shown.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Darwin was offered a position on the _________________ whose mission was to survey the waters around South America.
Arte-miy333 [17]

The correct answer is the ship beagle I think I spelled that right

6 0
3 years ago
A sequence of three nitrogenous bases in a messenger-rna molecule is known as a.
sergejj [24]

Answer:

A sequence of three nitrogenous bases in a messenger-rna molecule is known as <em><u>Codon</u></em>

Explanation:

Codon is a triplet of three nitrogenous bases present in mRNA. It can be any three from uracil, adenine, guanine or cytosine. They are arranged in specific order and code for specific amino acids.

5 0
2 years ago
Why are marshmellows scientificlly the best tasting thing ever?
yKpoI14uk [10]
Marshmallows are probably so delicious because of several important factors. They are fluffy, soft, and oh-so sweet. They melt in your mouth and taste absolutely heavenly with chocolate and graham crackers. Or throw a couple in your hot chocolate. There's no wrong way to eat them and they're pretty cheap too.
6 0
3 years ago
Read 2 more answers
Protective
Tatiana [17]
Plasma Membrane is the answer
7 0
3 years ago
Other questions:
  • The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
    14·1 answer
  • How do elements achieve stability? By reacting, which allows them to gain, lose, or share electrons.
    15·1 answer
  • Neville has low blood pressure and his pituitary started producing a hormone to maintain water balance. His blood pressure event
    13·2 answers
  • I don't understand either graph....
    6·1 answer
  • What sensors in our skin are responsible for the sense of touch?
    11·2 answers
  • In which process does some rainwater soak into the ground and replenish aquifers?
    15·2 answers
  • How is osmosis different from diffusion?
    14·1 answer
  • What is difference between sexual reproduction and asexual reproduction?
    10·2 answers
  • PLEASE HELP ME WITH THIS!
    14·1 answer
  • Which element would you expect to be more unstable/reactive, neon or calcium? why?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!