Which part of the brain connects the right and left hemispheres allowing communication between the two?

Vincenzo bellini, gaetano donizetti, and gioacchino rossini were all:

FromTheMoon [43]

<span><span>Vincenzo Bellini, </span><span>Gioacchino Rossini, </span>Gaetano Donizetti </span>were all opre singers they lived in germany and were classical opre singers they released an album in 1988 also i think this would fall under "arts"

6 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

PLEASE HELP QUICKLY !!!!

Karolina [17]

Answer:

not see clearly yrr.........

3 0

2 years ago

Gray matter on the surface of the brain is/are called

dsp73

<span>The whole brain is not gray matter, just the surface of it and parts of the interior, and there is other gray matter in nerve tissue along the spinal column. </span>

4 0

3 years ago

Read 2 more answers

Many Japanese people consume a diet rich in seaweed, including the edible red alga Porphyra, which is used for preparing sushi.

horsena [70]

Answer:

Bacteroides plebeius which is present in the gut humans have the same genes to marine bacterium Zobellia galactanivorans.

Explanation:

many researchers findout that bacteroides plebeius acquired functional porphyranase and agarase genes from a marine bacterium called Zobellia galactanivorans. Zobellia galactanivorans is a marine bacterium which has the ability to digest complex polysaccharides such as agarose and porphyran. so due to similar genes, Bacteroides plebeius also digest polysaccharides such as agarose and porphyran present in sea weed.

3 0

3 years ago