1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AVprozaik [17]
3 years ago
11

305°

Biology
1 answer:
Shalnov [3]3 years ago
5 0

Answer:

13x657

Explanation:

fyfdtyerdjytiu

\int\limits^a_b {x} \, dx \left \{ {{y=2} \atop {x=2}} \right.

You might be interested in
A few years after a prey species population decreases, the _____. A. prey population will exceed carrying capacity B. predator p
ikadub [295]

Answer:

D. predator population will decrease

Explanation:

If the population of prey species decreases then the competition between the predator population will increase and natural selection will act on them. So nature will select those individuals among predators who are more fit and adapted and less fit individuals will die.

So a few year after the predator population will decrease as there are not enough prey to support the large population of predators which was present when prey were abundant. Therefore the correct answer is D.

3 0
3 years ago
Read 2 more answers
What is the eyeball enclosed in?​
Debora [2.8K]

Answer:

sclera

The outer layer of the eyeball is a tough, white, opaque membrane called the sclera (the white of the eye). The slight bulge in the sclera at the front of the eye is a clear, thin, dome-shaped tissue called the cornea.

Explanation:

5 0
3 years ago
Read 2 more answers
What was the strength of the Southern colonies?
tester [92]
The answer for your question is 1. Easy to grow crops
4 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
What are two concerns of genetically modifying a child?
BabaBlast [244]
Genes and DNA of their parents i think its those two <span />
5 0
3 years ago
Other questions:
  • Select all the correct answers.
    13·2 answers
  • What is the most likely reason that horses and mountain goats have hooves?
    15·2 answers
  • Which represents a deletion of a section of the DNA shown here?
    13·1 answer
  • Summarize microevolution and macroevolution and describe the diiferce between the two
    13·1 answer
  • Why does fission occur with appotamy
    12·1 answer
  • Who was Dr. Joseph Bell?
    14·2 answers
  • A substance has a half-life of two days. If 10 days have passed, how many half-lives have the substance gone through?
    10·1 answer
  • You have just trypsinized your monolayer cells growing in a T25 flask. Once detached you resuspended all of your cells in media.
    5·1 answer
  • Guys do you see that profile 402557 on the daily ranking she is posting wrong answers to questions go and report her.
    12·1 answer
  • Regulatory enzymes are often the first enzyme in a multiple-reaction sequence. why might this be the case?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!