1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zzz [600]
2 years ago
11

Two ways that plants and living things depend on water

Biology
1 answer:
notka56 [123]2 years ago
7 0

Answer:

Plants need enough hydration to carry out photosynthesis.

Animals also need water to carry out cell activity.

You might be interested in
What changes resulted from the scientific revolution?
Artist 52 [7]

Answer:

The practice of physics, math, taxonomy, and more improved because of the scientific revolution.

8 0
2 years ago
In which place would you find the most organisms
Natalija [7]
Obviously on Earth :p nwm
8 0
3 years ago
Read 2 more answers
Valence is the number of electrons and atom must gain or lose it ordered to
bulgar [2K]

Valence is the number of electrons an atom must gain or lose in order to consummate its outer energy level or have a stable octet in its outer shell

8 0
3 years ago
Read 2 more answers
When did the Louisiana and Oklahoma territories belong to Spain? A. 1600 – 1762 B. 1762 – 1800 C. 1800 – 1803 D. 1803 – 1848
lozanna [386]
I believe the answer to this is B. 1762-1800.
6 0
2 years ago
Read 2 more answers
What is an example of a blood agent?
OLga [1]
Hydrogen Cyanide is an example of a blood agent.
4 0
3 years ago
Other questions:
  • Part E Water can exist in three different states of matter: solid, liquid, and gas. The water molecules are the same in each sta
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • 1) Which of the following best describes what causes plasma cells to form during a humoral immune response?
    11·1 answer
  • The lymphatic system is a fluid transport system vital for human health. Instead of blood, this system transports _________, whi
    13·2 answers
  • The building blocks or monomers of nucleic acid molecules are called _____. See concept 5.5 (page 84) view available hint(s) the
    5·1 answer
  • A sample of living tissue of a fish-eating bird species was found to have a specific, heavy metal concentration of 700,000 ppt (
    6·1 answer
  • What is the MAIN cause of increased erosion, especially for soil?
    13·2 answers
  • it is recommended for most adults that carbohydrates make a 45 through 65% of their diet, proteins make up 10 to 35% of their di
    5·2 answers
  • ____________________ is a significant rise in extinction rates above the natural background rate.
    9·2 answers
  • in humans, advanced aging mimics many symptoms of mitochondrial dysfunction. This provides support for:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!