1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet-ann [11.9K]
3 years ago
13

Feathers are modified ______. a. scales c. lipids b. hair d. tibia

Biology
1 answer:
Anuta_ua [19.1K]3 years ago
6 0
Feathers are modified as scales. According to the history, birds which have feathers are the descendants of the dinosaurs which have scales.
That's why feathers are categorized as scales in the present record according to studies. <span />
You might be interested in
The maximum number of wolves that can survive in a particular forest is 230. What is this number called?
levacccp [35]
The answer is a carrying capacity.

The carrying capacity is the maximum size of some population, for example, wolves population, that can survive in the given environment, in this case, the forest. It represents the number of animals that can live, reproduce, survive in the given area regarding the indefinite sustainability of this area in terms of resources (food, water, habitat, etc.)
4 0
4 years ago
Read 2 more answers
Glycogen in _____ is broken down and released into blood when blood glucose is low.
WINSTONCH [101]
A is the of this question.
5 0
3 years ago
the unicellular spores of the fern ceretopteris richardii are about 100 um in diameter.calculate the surface-area-to-volume rati
WINSTONCH [101]
The surface area will be:
S.A. = 6l²
S.A = 6(100 x 10⁻⁶)²

Volume = l³
Volume = (100 x 10⁻⁶)³

Surface area to volume ratio:
[6(100 x 10⁻⁶)²] / (100 x 10⁻⁶)³
S.A : Vol = 6 x 10⁴
4 0
3 years ago
A group of hikers find a fallen tree in a forest. The dead tree trunk is covered by mushrooms and other fungus. Later, they find
Evgen [1.6K]
D! They are both decomposing dead organic matter and metabolizing it through certain pathways to obtain energy! Hope this helped :)

7 0
3 years ago
Read 2 more answers
How much natural gas is used in the United States each year? How does this compare with oil and coal use?
kap26 [50]

Answer:In 2019, the United States consumed about 31.01 trillion cubic feet (Tcf) of natural gas.

Explanation:

3 0
3 years ago
Other questions:
  • Which definition correctly describes a haploid cell during meiosis?
    11·1 answer
  • What is the answer?
    12·1 answer
  • PLEASEE HELPP MEE !!!!!
    6·1 answer
  • Which characteristic is shared by all arthropods?
    12·2 answers
  • Compared to a polygenic trait, a single-gene trait tends to have
    9·2 answers
  • Which of the following example(s) does NOT cause bias in a research study.
    13·1 answer
  • A /plants &amp; animals
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • A bowling ball hitting pins and they fly backwards whicch <br> Newton’s law
    6·2 answers
  • Where can epithelial cells be found?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!