1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
4 years ago
10

A large power plant burns coal to generate electricity for nearby homes and businesses. This contributes most directly to which

short-term human-induced environmental change?
Biology
2 answers:
gogolik [260]4 years ago
6 0

Answer:

global warming

Explanation:

I think this is right. Hope this helps.

tatuchka [14]4 years ago
4 0

Answer:

global warming

Explanation:

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which carbon(s) on the sugar is(are) in dna is used to make the phosphate ester linkages? g?
Thepotemich [5.8K]
Both the 3’ carbon and 5’ carbon act in forming the phosphodiester linkages.
5 0
3 years ago
According to the current, predominant understanding of the disorder, genetic factors alone are enough to produce schizophrenia.
Assoli18 [71]

Answer:

The answer is FALSE.

Explanation:

Schizophrenia is a personality disorder that affects a person's ability to think, feel and behave clearly.

Although there is a very strong genetic component to schizophrenia, genes alone do not completely explain the illness. Rather it is believed that genes do not directly cause schizophrenia, but do make a person vulnerable to developing the disease alongside other factors such as the environment and altered brain chemistry and structure.

5 0
3 years ago
Read 2 more answers
Biology help!!
ser-zykov [4K]
Genetic variation is the answer to ur question
5 0
3 years ago
Estupefacientes o psicotrópicas productoras de dependencia física o síquica, capaces de provocar graves efectos tóxicos o daños
gladu [14]

Answer:

Drogas.

Explanation:

Las drogas son sustancias que tienen un efecto modificatorio sobre el estado normal de la psique. Por tanto, estas sustancias influyen en el comportamiento o la experiencia del usuario, pudiendo tener un efecto alucinógeno, pero también sedantes o una mixtura entre ambos.

El término se usa generalmente para indicar sustancias que tienen un efecto muy fuerte (por ejemplo, heroína, cannabis, mescalina, alcohol). Aunque los estimulantes cotidianos como el café y el chocolate también pueden tener un efecto en la psique, generalmente no se clasifican como sustancias psicoactivas debido a su efecto relativamente leve.

Los medicamentos que tienen un efecto sobre la psique se denominan psicofármacos. No obstante, los medicamentos que no se clasifican principalmente como psicofármacos, como los antihistamínicos, los agentes anti-mareo y los betabloqueantes, pueden también tener un efecto psicotrópico.

5 0
3 years ago
Other questions:
  • - What are the two main parts of the cell<br>cycle?<br>​
    7·1 answer
  • There are 206 bones in the human body in comparison to the bones how many muscles does the human body have
    9·1 answer
  • A one-year simulation is run with the settings shown below. The resulting yield was 6.6 tons per hectare, or 44% of the maximum
    14·1 answer
  • When scientists explore the world around them, they are:
    8·2 answers
  • Charles darwin's theory
    12·1 answer
  • In scientific notation, a number is expressed as a value between 1 and 10
    8·1 answer
  • Help fill this chart out !!!
    11·1 answer
  • Mechanism of photosynthesis
    10·1 answer
  • Which of the following best describes how meiosis helps maintain genetic variation?
    9·1 answer
  • Helppp this is due in 10 minutes!!!! (34 points) How, and why would some continent have more A-Allele than other continents?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!