These are natural causes of earthquakes.
<h3>What are earthquakes?</h3>
- An earthquake is the shaking of the Earth's surface caused by a sudden release of energy in the Earth's lithosphere, which generates seismic waves.
- It is also referred to as a quake, tremor, or temblor.
- Earthquakes can range in strength from those that are so small that no one can feel them to those that are so powerful that they upend entire cities and send people and objects flying.
- The number, kind, and size of earthquakes that occur in a region over a specific time period is known as its seismic activity.
<h3>The earthquake paragraph is what?</h3>
- Disturbances in the equilibrium of the earth are what generate earthquakes.
- The various tectonic plates steadily pass one another.
- They become tense when they become stuck.
- The sudden release of the tectonic plates, which causes them to move swiftly, causes the earthquake.
Learn more about earthquake here:
brainly.com/question/1296104
#SPJ4
Answer:
d
Explanation:
cuzzz.... i took test on edge
Answer: A - an island with a long history of self-rule and a homogeneous ethnic identity, although the island has been under the control of a colonial power for the last 30 years.
Explanation:
A nation is a stable community of people, formed on the basis of a common language, territory, history, ethnicity, or psychological make-up manifested in a common culture.
It is a cultural-political community that has become conscious of its autonomy, unity, and particular interests.
Nations are like islands surrounded by water and they have previously under the colonial rule before they gained independence.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
