1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
12

Which statement is true about the solar system? A) Inner planets have more moons than outer planets have. B) Inner planets are g

aseous; outer planets are terrestrial. C) Inner planets orbit at a lower rate than outer planets do. D) Inner planets are more dense; outer planets are less dense.
Biology
2 answers:
Alina [70]3 years ago
6 0

(D)Inner planets are more dense; outer planets are less dense.

is you answer

stiks02 [169]3 years ago
5 0
I would have to say its D. 
You might be interested in
Which are characteristics of scientific questions? Check all that apply.
lisov135 [29]

Answer:

asking about subjective matters, addressing a gap in knowledge, and already having fully confirmed explanations

Explanation:

4 0
3 years ago
Oxygen unloading occurs at the _________________________ This process causes a(n) _________________ in the oxygen partial pressu
Papessa [141]
<span>The answer to this question would be: tissues; decrease

Oxygen is delivered to the tissue by the heart. It will be unloaded in the tissue, causing the oxygen level in the blood to be decreased. After that, the blood also picks up the carbon dioxide so its level will be increased. 
In lungs, the carbon dioxide will be unloaded and oxygen will be loaded back into the blood.</span>
7 0
3 years ago
#8 - The Genetic Code<br> 18. How many amino acids are involved in the production of proteins?
Phoenix [80]

Answer: 20 amino acids

Explanation:

The Genetic code permits the triplet nature of codons whereby three nucleotides from Adenine, Uracil, Guanine and Cytosine on the messenger RNA (mRNA) join to form 64 codons.

Since more than one codon can specify for an amino acid, the 64 codons then specify for 20 amino acids, that then form the sequence of various proteins

7 0
3 years ago
Read 2 more answers
What do african birds eat and pic​
Vanyuwa [196]

Answer:

if these mixtures are feed as only source of food African grey parrots become ill and ultimately die.

not sure about the answer but see if this is correct.

4 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • The suns energy is classified by the
    6·2 answers
  • Are all these forces balanced or unbalanced?
    8·1 answer
  • A star’s apparent magnitude is a measure of
    13·2 answers
  • At a fault block, one portion of the block moves upward while the adjacent portion moves downward. What is the upper portion cal
    14·2 answers
  • 1. In what ways are mollusks and annelids alike?
    10·1 answer
  • Can someone help on this science question please.
    11·2 answers
  • Information found on the chromosome of an organism would MOST affect which statement?
    15·1 answer
  • 4. In the process of precipitation, water vapor in air cools and becomes water droplets that clump around particles in air to fo
    8·1 answer
  • Between which two atoms of water are hydrogen bonds are formed?
    11·1 answer
  • Why does the electron transport chain (etc) pump protons out of the mitochondrial matrix and into the space between the membrane
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!