Amino acids are essentially the "building blocks" of proteins. You could think of it as an individual amino acid combining with others to form a link or stand.
DNA is the main type of genetic material found in a cell. In addition, it is found in the nucleus of the cell, so (D) is correct. DNA in the nucleus is used in replication (through mitosis and meiosis) via daughter cells to continue cell growth.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
