1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
15

DNA and RNA are which types of macromolecule?

Biology
2 answers:
blagie [28]3 years ago
6 0
They're Nucleic Acid :)  
saw5 [17]3 years ago
5 0
Dna is a-<span>Deoxyribonucleic acid 
</span>Rna- is also a nucleic acid
You might be interested in
The second stage of the digestive process takes place in the
Lunna [17]
The second stage takes place in the estogagus which leads to the stomach then the small intestine then the big intestine and then the toilet there
you welcome
6 0
3 years ago
Which two layers are part of the thermosphere?
choli [55]

Answer:

The exosphere and the ionosphere

3 0
3 years ago
Read 2 more answers
Clown fish live in the waving tentacles of sea anemones in the ocean. The sea
ahrayia [7]

Answer:

d i thank?

Explanation:

3 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Black eyes are dominant to orange eyes, and green skin is dominant to white skin. sam, a mendalien with black eyes and green ski
Ilia_Sergeevich [38]
<span>Sam, a mendalien with black eyes and green skin, has a parent with orange eyes and white skin. Sam has a dominant phenotype expressed but he has a parent with a recessive phenotype which means he has a heterozygote gene.

Carole is a mendalien with orange eyes and white skin. Since Carole express both recessive phenotypes she should be homozygote recessive.

The key to this problem is how Sam dominant gene will be inherited. Since there are two heterozygote genes, it will be 50% dominant gene inherited for each phenotype. Then the result should be: 
25% Dominant + Dominant =</span>black eyes and green skin<span>
25% Dominant + Recessive =</span>black eyes and white skin
25% Recessive + Dominant  =orange eyes and green skin
25% Recessive + Recessive =orange eyes and white skin
8 0
3 years ago
Other questions:
  • Who suggested that the Sun and moon orbited Earth, and the rest of the planets orbited the Sun
    10·2 answers
  • Will give Brainliest to the 1st person to answer this question! Explain at least two positive effects of the cell cycle on the h
    7·1 answer
  • Why is field flooding used More Often by Farmers than drip or sprinkler irrigation
    11·1 answer
  • The graph below shows genotype percentages for generations 20 through 26. The initial genotype percentages were 34% DD, 32% Dd,
    6·1 answer
  • What is a joint? describe the function of movable joints in the body?
    15·1 answer
  • What type of plate boundary caused the formation of the Himalayas? Name another example of a mountain range that formed in this
    9·1 answer
  • Which describes the role of carbon dioxide in photosynthesis?I will give brainliest!
    7·1 answer
  • A muscular tube that connects your mouth to your stomach
    6·1 answer
  • 12. How heavy are some of the tools technicians use in the turbine?
    9·1 answer
  • Which of these statements about the theory of evolution are correct
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!