Answer: 25 of the chicks will be black
Explanation: Since the chickens are intermediate in colour, that is they are not black, they are heterozygous. Let B represent the allele for black colour and B represent the allele for blue colour, therefore the genotype of a chicken with an intermediate colour is Bb. A cross between two Bb chicken will produce 1 BB, 2 Bb and 1 bb chicks. 1 BB will manifest outwardly as black, 2Bb will manifest outwardly as intermediate colored while 1 bb will manifest outwardly as blue colored chicks.
Since one out of four chicks are black colored, if the two chicken produced 100 chicks, the number of chicks that will be black is 1/4 x 100 = 25. Therefore, 25 chicks out of 100 will be black.
See the attached punnet square for more information
Answer:
C
Explanation:
Trees take up carbon dioxide from the atmosphere and reduce to make carbohydrates. This is powered by the energy of the sun that is taped by chlorophyll pigments during photosynthesis. The energy is used to split water molecules into H+ and O2-. Then the following chemical reaction ensues;
6CO2 + 6H2O ------> C6H12O6 + 6O2
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Results suggest that under present circumstances, Australia and the USA each should take responsibility of 10 per cent each of the overall global share of climate refugees, followed by Canada and Saudi Arabia (9 per cent each), South Korea (7 per cent) and Russia, Germany and Japan (6 per cent each).
Explanation:
please mark as brainlist answers
