1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimaraw [331]
3 years ago
6

Please I NEED help!!!

Biology
1 answer:
Aleks [24]3 years ago
8 0

Answer:

It can cause land subsidence

Explanation:

You might be interested in
florida panthers have had to adapt to a changing environment. how did this almost cause the extinction of the species?
dusya [7]
They had to change they way they live which is quite difficult it is like you going to a new school in a new state and not being used to anyone
5 0
2 years ago
This has to do with blind spots: What parts of the eye are involved with this inability to see? How do these eye parts function?
Slav-nsk [51]

Answer:

  • Blindspot
  • It has a vital role. It is the only way out of the optic nerve. By this hole optic nerve exits from the eye and goes towards the brain.
  • It can be proved by a simple experiment. A paper sheet is taken. Then a cross and a circle are drawn side by side on that paper. Then we will focus on the cross. Then by closing one eye and by bringing the paper slowly towards our face, the circle will be disappeared at a certain point.        

Explanation:  

The blind spot is a region on the retina where ganglion cells connect with the optic nerve, and the optic nerve and blood vessels leave the eyeball. There are no receptors in this area so nothing can be translated into vision. That's why the blind spot is unable to see things.

6 0
3 years ago
In pea plants, the allele for tallness is dominant. What are the possible genotypes of a tall pea plant?
andreev551 [17]
TT or Tt because even though the second letter is not dominant the first one is greater
6 0
3 years ago
Read 2 more answers
What are two plants and their plant adaptations in the tropical rainforest?
aleksley [76]

Answer:

1. Lianas - these are woody vines that have roots in the ground but climb up the trees to reach the sunlight. Their leaves and flowers grow in the canopy.

2. Tree trunks - these are tall and thin to allow trees to reach the sunlight.

Hope it helps

Please mark me as the branliest

Thank you

7 0
3 years ago
Energy is defined as the ability to what
ddd [48]
Energy is defined as the ability to do work
4 0
3 years ago
Read 2 more answers
Other questions:
  • What circumstances are best for fossils to form? Select all that apply. Rapid burial absence or limited oxygen supply undistrube
    7·2 answers
  • Consider an atom of gold in which the nucleus contains 79 protons and 118 neutrons. What is its atomic number and atomic mass nu
    14·1 answer
  • Which of the following organisms would you expect to find in a layer of rock at the bottom of a deep canyon? a) an ammonite b) a
    13·1 answer
  • What Do You Get When You Multiply An Object's mass times the acceleration?
    9·2 answers
  • I need help with these questions!! (Biology) 28 Points!!
    5·1 answer
  • A protozoan that divides to form two daughter cells just like itself would be undergoing _____.
    9·2 answers
  • How can biotic and abiotic factors affect the size of a population? Give an example of a biotic and an abiotic factor that could
    8·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • PLEASE HELP ASAP THE QUESTION IS IN THE PICTURE
    10·1 answer
  • Identify the three domains and the different groups or kingdoms within each domain (marine science)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!