Answer:
The correct answer is : prokaryotic organisms like E. coli and higher organisms share common ancestor.
Explanation:
E. Coli is a prokaryotic organism or bacteria. On the metabolic level these organisms share similar homology with the higher organism other than this these organisms also show same core functions with higher level organisms such as elephant.
These similarities suggest that the all the living organisms share a common ancestor. The french scientist Jacques Monod statement "Anything found to be true of E. Coli must also be true of elephants." is also based on this notion.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
When unspecialized stem cells give rise to specialized cells, the process is called differentiation. ... The interaction of signals during differentiation causes the cell's DNA to acquire epigenetic marks that restrict DNA expression in the cell and can be passed on through cell division
