Answer:
The correct answer is "The nervous system transmits pain, while the endocrine system elicits the fight or flight response".
Explanation:
One of the roles of the nervous system is to transmit pain to alarm the body that something is going on and that it acts accordingly. The nerve pathway is the one that carries the message of pain from the affected area to the spinal cord and up to the brain. On the other hand, the endocrine system is the one that elicits the fight or flight response. During stressful conditions, the adrenal glands of the endocrine system release epinephrine and norepinephrine that acts during the fight or flight response.
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
Answer:
Gravitational redshift
Explanation:
Gravitational redshift, changes in a planet's orbital path, gravitational lensing provides concrete evidence for the general theory of relativity. Hope this is helpful and the answer you were looking for!
Your answer would be A. The earth element stays in the same area of the lithosphere, hydrosphere, or atmosphere where they originated when the earth was formed.
Answer: In Spanish
¿Cómo se vuelven resistentes las bacterias a los antibióticos?
R: Las bacterias pueden volverse resistentes a los antibióticos de varias maneras. Algunas bacterias pueden "neutralizar" un antibiótico cambiándolo de una manera que lo hace inofensivo. Otros han aprendido a bombear un antibiótico fuera de la bacteria antes de que pueda causar algún daño. Algunas bacterias pueden cambiar su estructura externa, por lo que el antibiótico no tiene forma de adherirse a la bacteria que está diseñada para matar.
Después de exponerse a los antibióticos, a veces una de las bacterias puede sobrevivir porque encontró una manera de resistir el antibiótico. Si incluso una bacteria se vuelve resistente a los antibióticos, puede multiplicarse y reemplazar todas las bacterias que fueron eliminadas. Eso significa que la exposición a los antibióticos proporciona una presión selectiva que hace que las bacterias sobrevivientes sean más propensas a ser resistentes. Las bacterias también pueden volverse resistentes a través de la mutación de su material genético.
Answer in English :
How do bacteria become resistant to antibiotics?
A: Bacteria can become resistant to antibiotics through several ways. Some bacteria can “neutralize” an antibiotic by changing it in a way that makes it harmless. Others have learned how to pump an antibiotic back outside of the bacteria before it can do any harm. Some bacteria can change their outer structure so the antibiotic has no way to attach to the bacteria it is designed to kill.
After being exposed to antibiotics, sometimes one of the bacteria can survive because it found a way to resist the antibiotic. If even one bacterium becomes resistant to antibiotics, it can then multiply and replace all the bacteria that were killed off. That means that exposure to antibiotics provides selective pressure making the surviving bacteria more likely to be resistant. Bacteria can also become resistant through mutation of their genetic material.
I don't know if this help you at all.
