1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
12

On the periodic table, elements are grouped in columns with other elements that share ___.

Biology
2 answers:
Ivan3 years ago
8 0
C same chemical properties 
alisha [4.7K]3 years ago
7 0
I think the answer is c
You might be interested in
What is the use of an animal cell​
777dan777 [17]

Answer:

it mostly controls all activites

Explanation:

the cell is main structural and functional unit of life in an animal body so without an animal cell the body won't function at all

4 0
3 years ago
Read 2 more answers
If a person develops high blood pressure, one of the compensatory mechanisms that comes into play is the fluid shift mechanism.
ra1l [238]

Answer:  shift

Explanation:

4 0
3 years ago
If a plant is considered “drought-resistant“ does it require more or less water to perform photosynthesis?
leonid [27]

Answer:

Less water.

Explanation:

If the plant is "drought-resistant" then that should mean less water is required for the plant to perform photosynthesis.

6 0
3 years ago
Give two reasons why humans need a balanced ecosystem <br>​
satela [25.4K]

Answer:

us humans need a balanced ecosystem because its what keeps us alive. when having a balanced ecosystem we have cleaned water, purified air, maintained soil, regulates our climate, recycles nutrients, and provides us with food.

6 0
3 years ago
Read 2 more answers
Is a catalyst a macromolecule?
Arlecino [84]
No, a macromolecule is a large organic molecule

Hope this helps

3 0
3 years ago
Read 2 more answers
Other questions:
  • Is a wolf a producer
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the benefit to a society if everyone reduces the amount of meat they eat?
    13·1 answer
  • Identify at least six different types of private healthcare facilities
    9·2 answers
  • An insect gets trapped in tree sap. The sap dries, and the insects are preserved exactly as they were in real life.
    7·2 answers
  • Proteins and fats are important for the cel. Which organelle below does NOT play a role in the production of one or more of thes
    8·1 answer
  • What is Natural selection
    15·1 answer
  • The development of specific plant structures in particular locations is called pattern formation. Events in a plant's early deve
    6·1 answer
  • Cigarette smoking is a factor in causing all of the following conditions except
    6·2 answers
  • How does solubility affect materials on Earth?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!