3 years ago

How is an organism different from what we would define as a population?

Biology

1 answer:

slamgirl [31]3 years ago

4 0

Answer:

An organism is a single individual whereas a population is multiple individuals of the same species

Explanation:

ex: a single lion is an organism, a pride of lions is a population

Def of organism: A plant/animal/single-celled life form that grows and responds to its environment

You might be interested in

Identify structures found in fungi

andrew11 [14]

Answer:

Its the third one

Explanation:

7 0

3 years ago

which of the following statements is true? A.) Both unicellular and multicellular are at some risk of having too much water ente

andrew11 [14]

A is your answer.
Water containing no salt is known as isotonic solution

4 0

3 years ago

PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?

Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0

3 years ago

Read 2 more answers

Describe how a zygote with trisomy 21 is likely to<br> occur during fertilization.

maks197457 [2]

Answer:

If the paired chromosomes fail to separate during meiosis in the female, then the resulting daughter cells will receive either 2 or no copies of chromosome 21. If the resulting egg with 2 copies of chromosome 21 is fertilized with a normal sperm, the resulting zygote with be trisomy 21

Explanation:

5 0

2 years ago

Was the answer im doing a test rn

katrin2010 [14]

Answer:

heh

Explanation:

you shouldn't be questioning if you're in a live test

7 0

3 years ago