Oatmeal and yams for carbohydrate. Two in high fat whole eggs and avocados. High in protein is seafood and beans.
Your answer will be False!
<span>A tropism is a movement of an organism toward or away from a stimulus. A positive tropism is when the organism moves toward the stimuli. A negative tropism is when the organism moves away from the stimuli. So, your answer will be negative tropism, since the stem is growing up and out of the soil, AWAY from gravity.</span>
The correct answer is the "superior temporal sulcus".
Superior Temporal Sulcus is described as the sulcus isolating the advanced temporal gyrus from the middle temporal gyrus in the temporal lobe of the brain. The advanced temporal sulcus is the primary sulcus not so good as the lateral fissure. latest research monitor multisensory processing talents. Studies has shown the recorded activation in the STS because of 5 precise social inputs, and therefore the STS is believed to be implicated in social perception.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: