1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
11

How does a diversity of organisms increase the chances that some will survive a major change in environment ?

Biology
1 answer:
Slav-nsk [51]3 years ago
7 0
<h2>Answer:</h2>

This can be explained with an example.

Let’s lake an example of two species 1 and 2.

Species 1 has a wide genetic diversity due to which organism are also diverse in phenotype. Their phenotype are:  

Black, dark brown, brown, dark red, red, light red, pink, skin color.

From left to right organism are becoming less adapted to high temperature relatively.

For species 2:  This species has less genetic diversity and its phenotypic diversity is as follow:

Black, red, Skin color.

From left to right organism are becoming less adapted to high temperature relatively.

Now if there is the sudden high temperature in the environment; 4 Types of phenotype will survive are black, dark brown, brown, dark red.

While there will only two types of organism in specie 2 which will survive are black, red.

So that’s how the diversity of organisms increase the chances that some will survive a major change in environment.


You might be interested in
The cell cycle is the life cycle
antiseptic1488 [7]

Answer:

The cell cycle is the life cycle  

16

They lack nuclei, so prokaryotes do not undergo mitosis.(instead they preform binary fission)

The cell produces organelles during _____I don't know how to answer this. While the answer is G2phase of interphase that wouldn't result in two diploid cells you would have to specify that mitosis produces two cells  

results in the formation of two new cells.

I hope I was somewhat helpful  

6 0
3 years ago
How can a catastrophic global event influence evolutionary change? Group of answer choices Undesirable versions of genes are rem
ExtremeBDS [4]

Answer:

Only some species may survive the event

Explanation:

Evolution is most likely to occur when catastrophic events alter community composition. Catastrophic global event can influence that only the hardiest, generalist species may survive. Specialists may be left without food and starve.

8 0
3 years ago
Please answer quickly!
kirill [66]
By looking at the diagram, and my knowledge of Punnett squares, i would say B. 4:16
4 0
4 years ago
True or False: If one wanted to promote the growth of coliform bacteria, but inhibit the growth of non-coliform bacteria, one wo
Sloan [31]
Answer : True

Enrichment cultures are used to increase a small number of desired organisms
6 0
3 years ago
Why does a submarine rise when its volume is increased? a. Because it now weighs less c. Because it fills with air b. Because it
Lunna [17]

Answer:

A

Explanation:

A

5 0
3 years ago
Other questions:
  • What are some similarities between inherited and acquired traits?
    10·1 answer
  • Mutualism in a sentence
    15·1 answer
  • Why is the ability to move important to animals
    14·1 answer
  • O que é membrana plasmatica?
    12·1 answer
  • What four kingdoms are in the domain eukarya
    8·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • . The trait that would be least useful in a phylogenetic analysis would be one that A) is detectable only in observations of ear
    11·1 answer
  • Choose the answer that has these events of protein synthesis in the proper sequence 1. The first tRNA with Met binds to the P si
    13·1 answer
  • In the spotted tulip, white flowers are dominant to yellow (gene Y), and axial flowers are dominant terminal flowers (gene T). E
    5·1 answer
  • Snapdragons are a type of flower. When red snapdragons are crossed with white snapdragons the resulting flowers are all pink. A
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!