1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
7

Which legal doctrine, created by the Supreme Court in 1909, states that corporations are liable for the actions of employees who

commit a crime in the course of their employment when their act was for the benefit of the company?
Law
1 answer:
Anestetic [448]3 years ago
3 0

Answer:

Vicarious Liability

Explanation:

You might be interested in
Explain consequences of interfering with the right to vote on the rule of law.
Neporo4naja [7]
The answer is B. It creates a misinterpretation in understanding the con situation.
8 0
3 years ago
Read 2 more answers
The Interactive activities in in course ___.
stealth61 [152]
It’s B in my opinion
3 0
2 years ago
If you were in a position to make changes to how crime is prevented in your community, which of the strategies in this lesson wo
Andrew [12]

Answer:

because it will be for the betterment of the community, also it would make a diffreence by enforcing public laws to govern the community or country

6 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Provide a summary of the 10 sections of the legislative Branch.
dimaraw [331]

Answer: Sorry it took a while, This is all I remember I will let you know if I remember anymore.

Explanation:

House of Representatives

There are 435 total Representatives in the House. Each state has a different number of representatives depending on their total population. States with more people get more representatives.

Representatives are elected every two years. They must be 25 years old, have been a US citizen for at least 7 years, and live in the state they represent.

The Speaker of the House is the leader of the House of Representatives. The House elects the member they want to be the leader. The Speaker is third in line in succession to the President.

The Senate

The Senate has 100 members. Each state has two Senators.

Senators are elected every 6 years. To become a Senator a person must be at least 30 years old, have been a US citizen for at least 9 years, and must live in the state they represent.

Making a Law

For a law to be made it must go through a bunch of steps called the Legislative Process. The first step is for someone to write a bill. Anyone can write a bill, but only a member of Congress can present it to the Congress.

Next the bill goes to a committee that is an expert on the subject of the bill. Here the bill may be rejected, accepted, or changed. The bill may go to a number of committees. Experts are often brought in to witness and give their opinions on the pros and cons of a bill. Once the bill is ready and the committee agrees, it goes before the entire Congress.

Both the House and the Senate will have their own debates about the bill. Members will speak for or against the bill and then the Congress will vote. A bill must get a majority of the votes from both the Senate and the House of Representatives to pass.

The next step is for the President to sign the bill. The president can sign the bill into law or choose to veto the bill. Once the president veto's a bill, congress can then try to override the veto by getting two thirds of the vote from both the House and the Senate.

Other Powers of Congress

In addition to making laws, congress has other responsibilities and powers. These include creating an annual budget for the government and taxing the citizens to pay for it. Another important congressional power is the power to declare war.

The Senate has the specific job to ratify treaties with other countries. They also confirm presidential appointments.

Congress also performs government oversight. They are supposed to make sure that the government is spending the tax money on the right things and that the different branches of government are doing their jobs.

7 0
3 years ago
Other questions:
  • i just made this account and forgot the password and im subscribed to plus and the change password isnt sending a mail to my ema
    5·2 answers
  • Identify the sentence that uses a relative pronoun to make the second part a dependent clause.
    7·1 answer
  • The most common form of consequence-oriented reasoning is known as
    10·2 answers
  • HURRY PLSS
    8·1 answer
  • "Pro-death" is a loaded phrase? T or F
    8·2 answers
  • 1 delegated power that Congress has and give me an example of how congress can use it.
    15·1 answer
  • When a court decision is final it gives an example to follow for future cases that are similar in nature. What is this called
    7·1 answer
  • At a minimum how many days per year must workers perform class i class ii
    15·1 answer
  • 6. Describe one thing you think your representative should do.
    8·1 answer
  • Bicyclists may ride in the left lane if they are on a one-way street with two or more lanes.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!