1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
13

63 cm and 6 m wich one is great than other

Biology
2 answers:
enot [183]3 years ago
7 0
Well 1m = 100cm
so 6m = 600cm. 600cm > 63cm. Hence, 6m is greater.
nevsk [136]3 years ago
5 0
6 m because 12 cm equals 1 foot a meter is bigger than a foot
You might be interested in
Proteins, large complex molecules, are major building blocks of all living organisms. Discuss the following in relation to prote
Anastasy [175]

Answer:

Proteins, large complex molecules, are major building blocks of all living organisms. Discuss the following in relation to proteins.

(a) The chemical composition and levels of structure of proteins.

Proteins are chemically macromolecules formed by manomeric units called amino acids. The structural organization of proteins is as follows:  Primary, Secondary, Tertiary and Quaternary.

(b) The roles of DNA and RNA in protein synthesis

From DNA, ribosomal RNA is formed, a type of RNA present in ribosomes that is responsible for protein synthesis. Therefore, the role of DNA in protein synthesis is essential: without DNA, there are no proteins.

(c) The roles of proteins in membrane structure and transport of molecules across the membrane

Proteins can work by transporting ions in different ways.

Explanation:

(a) The chemical composition and levels of structure of proteins.

Proteins are chemically macromolecules formed by manomeric units called amino acids, these have in their structure a carboxyl group and amino group, attached to the same carbon. To be assimilated by the body, proteins must be degraded in the amino acids that make them up.

The amino acids are linked together by peptide bonds. In those bonds, the amino group of one amino acid reacts with the carboxyl group of the other.

The structural organization of proteins is as follows:

Primary: Sequence of the amino acids in the chain with peptide bonds.

Secondary: Spatial arrangement of the amino acids of a protein. They stabilize by means of hydrogen bonds. There are two types: the propeller a and the folded blade b.

Tertiary: Three-dimensional arrangement of the polypeptide chain, stabilized by forces of Waals.

Quaternary: Union of weak bonds of arias polypeptic chains that originate a protein complex.

(b) The roles of DNA and RNA in protein synthesis

RNA fulfills numerous functions, the most important being protein synthesis, in which it copies the genetic order contained in the DNA to use it as a standard in the manufacture of proteins and enzymes and various substances necessary for the cell and the organism. For this, it goes to the ribosomes, which operate as a kind of molecular protein factory, and it does so following the pattern that the DNA prints on it.

(c) The roles of proteins in membrane structure and transport of molecules across the membrane

The cells contain proteins that are embedded in the lipid bilayer of their plasma membranes. These proteins can work by transporting ions in different ways. Then, most of the water-soluble ions and molecules are unable to spontaneously cross the lipid bilayer of the membrane (which act as a barrier) and require the concurrence of special carrier proteins or protein channels. In this way the cell maintains concentrations of ions and small molecules different from those prevailing in the external environment.

7 0
3 years ago
How many protons are in the nucleus of an atom with an atomic number of 12?
Akimi4 [234]

<h3>16 protons</h3><h2> </h2>

I hope it helps for you

4 0
3 years ago
HURY PLEASEEE
Ronch [10]

Answer:

A. up to nine times the mass of the sun. 100%

Explanation:

please mark brainliest

6 0
2 years ago
Read 2 more answers
Folexa is the largest producer of spices in the world, and its location is an added advantage to its business. It is surrounded
jolli1 [7]
<h2>Agglomeration</h2>

Explanation:

  • The term agglomeration is an economic term used to refer to the phenomenon of firms being located close to one another. There are a number of components we'll explore later in this lesson, but for now, just remember that agglomeration relates to clusters of population or business activity.
  • Agglomeration, the adhering of particles to each other or to strong surfaces, is a characteristic marvel.  
  • Agglomeration also changes the mass attributes of particulate solids typically to improve things. Bigger particles have less residue, display improved stream conduct, and highlight decreased staying inclinations.
  • Hence, the right answer for the fill up the blank is "Agglomeration"

8 0
3 years ago
What is the tallest animal alive
Natalka [10]

Answer:

giraffe

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Explain the problem if too much nitrogen enters an aquatic ecosystem
    13·1 answer
  • Describe two (2 ways bacteria are helpful to your body.
    6·1 answer
  • You are treating a patient who has an implantable cardioverter defibrillator (icd) and is in cardiac arrest
    6·1 answer
  • 5. What is the decay product of Uranium-238?
    10·1 answer
  • A client suffering from an asthma attack is brought to the emergency department. The client's body temperature is 98.4 f, pulse
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Chemical processes that involve one or more chemical reactions keep living things alive. Which of these types of chemical reacti
    7·1 answer
  • Question 1
    14·1 answer
  • What kind of mutation has occurred during the DNA replication shown in the diagram
    6·2 answers
  • Which structure in the diagram below is a muscle that contracts during inhalation?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!