Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
I'm not totally sure. But in my view, <span>(4)a salt solution</span> would be used to prove that the gas produced by the yeast in the vacuum bottle could change the pH of the liquid in the flask
Answer: Genome is the haploid set of chromosomes in a gamete or microorganism, or in each cell of a multicellular organism. Replicative is relating to or involving the replication of genetic material or living organisms.
Explanation:
So Replicative Genoes are genomes that are able to replicate its own genetic material.
The correct answer for this question is:
A farmer planted legumes and cabbage in the same field that is devoid of fertilizers. The yield from this field is better than the cabbage planted inanother field without legumes. The reason for this is because (A) <span>nitrogen-fixing present in the roots of legumes aid enrichment of nitrogen in the soil.</span>
