The correct answer is: A. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell.
Plasma membrane of the cell is arranged in a bilayer of phospholipids. Phospholipids are amphipathic molecules which means that they have both hydrophilic and hydrophobic regions. The hydrophilic heads of phospholipids that are faced outward and hydrophobic layer located in the interior of the bilayer together make a good barrier between the interior and exterior of the cell, so the water and other polar or charged substances cannot easily cross the hydrophobic core of the membrane.
<span>The cortex is the outermost layer of brain cells. Thinking and voluntary movements begin in the cortex.
</span><span>The occipital lobes contain the brain's visual processing system.</span>
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
We explain this puzzle-piece-like build as proof of tectonic plate shifting. As magma inside the earth moves, so do the continental plates on top of the magma. The continents used to be fused together in one larger continent called Pangea. Over the course of 1000s of years, the plates have shifted.
tldr: tectonic plate movements cause this phenomena
Answer:
Option C: Proteins, the daughter would have stunted growth due to the inability to produce new tissue and muscles.
Explanation:
Proteins are the building blocks of the body and it is a necessity to carry out normal metabolism and cell sign.
