1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RideAnS [48]
3 years ago
13

During the process of DNA replication, the whole molecule gets copied in the [A] phase of the cell cycle. The DNA strands are se

parated by the enzyme [B] while [C] keeps it from overwinding. The 2 strands are copied differently. The [D] strand is made continuously, while the [E] strand is synthesized in small sequences called Okazaki fragments. The main enzyme involved in DNA replication is [F]. This enzyme can only add nucleotides to an existing strand, so short sequences of [G] made by the enzyme [H] are needed for the process of elongation. In the [U] strand, the enzyme DNA polymerase one removes the short tj sequences and fills the gaps, while [K] joins the fragments.
Biology
1 answer:
Sveta_85 [38]3 years ago
8 0

Answer:

Synthesis, DNA helicase, topoisomerase, leading strand, lagging strand, DNA polymerase, nucleotides, primase, lagging strand, nucleotide, DNA ligase

Explanation:

During the process of DNA replication, the whole molecule gets copied in the <u>synthesis or S</u> phase of the cell cycle. The DNA strands are separated by the enzyme <u>helicase</u> while <u>topoisomerase</u> keeps it from overwinding. The 2 strands are copied differently. The <u>leading</u> strand is made continuously, while the <u>lagging</u> strand is synthesized in small sequences called Okazaki fragments. The main enzyme involved in DNA replication is <u>DNA polymerase</u>. This enzyme can only add nucleotides to an existing strand, so short sequences of <u>nucleotides (primer)</u> made by the enzyme <u>primase</u> are needed for the process of elongation. In the <u>lagging</u> strand, the enzyme DNA polymerase one removes the short tj sequences and fills the gaps, while <u>DNA ligase</u> joins the fragments.

A Synthesis,

B DNA helicase,

C topoisomerase,

D leading  

E lagging strand

F DNA polymerase

G nucleotides

H primase

I lagging strand

J nucleotide

K DNA ligase

You might be interested in
Do we follow the natural order? We as humans, do follow Mother Nature rules?
Arte-miy333 [17]
Yes we have to maintain homeostasis so our bodies have to adapt to Mother Nature
5 0
3 years ago
Is a birth mark really the place a relative got killed in the past?
Arte-miy333 [17]
Nah that shi made up
5 0
3 years ago
Read 2 more answers
Which of the following forest management practices keeps the forest in a state of mid to late succession?
kvv77 [185]

Answer:D SEED TREE CUTTING

Explanation:

The answer is seed- tree cutting. Edge2020

4 0
3 years ago
Read 2 more answers
Which is not a compound?<br> 8H2<br> H2O<br> 6CaO<br> 5HCl
poizon [28]
8H2. The actual equation doesn't make sense for 8H2. This is because in compounds it always says the number of atoms after the element symbol, but in this case, there is an 8 before it. This means that it isn't a compound. 
3 0
4 years ago
Read 2 more answers
What is the relationship between substance abuse and the spread of STIs?
Delicious77 [7]
Substance abuse can spread STIs because when a user shares needles with an infected person, it can spread through the blood. Any high-risk behavior like this spreads STIs.
4 0
4 years ago
Other questions:
  • What is island biogeography
    10·1 answer
  • The complex of dna, rna, and associated proteins that gives shape to the chromosome is called
    5·1 answer
  • WILL GIVE BRAINIEST!! PLEASE HELP ASAP!!
    5·1 answer
  • Nearer to the medullary cavity, the ____________ is marked by an expansive production of chondrocytes that align in rows in orde
    10·1 answer
  • Where does the arrows go
    11·1 answer
  • The four techniques employed when using surface anatomy for diagnosis are
    15·1 answer
  • Which cell structure serves the stated function in both eukaryotic and prokaryotic cells?
    8·2 answers
  • What is the number of chromosomes found in a parent cell?
    6·2 answers
  • Write a short story about a piece of corn and its journey through the digestive system. It should be in first person. Be creativ
    15·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!