1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
12

A substance with a ph of 5 is called

Biology
2 answers:
ddd [48]3 years ago
6 0

Answer:

A pH of 7 is neutral. A pH less than 7 is acidic. A pH greater than 7 is basic. The pH scale is logarithmic and as a result, each whole pH value below 7 is ten times more acidic than the next higher value. For example, pH 4 is ten times more acidic than pH 5 and 100 times (10 times 10) more acidic than pH 6.

Please said thanks

igor_vitrenko [27]3 years ago
4 0

Answer:

acid

Explanation:

The pH scale is from 0-14.  7 is neutral, anything less that 7 is an acid & anything greater than 7 is a base (alkaline)

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Viruses and bacteria are both microscopic and can both cause disease. viruses differ from bacteria in that all viruses *
Semenov [28]
C.) viruses need a living host to reproduce... this is cause by viruses being Dioxyriboneuclicacid(DNA) surrounded by a protien shell so viruses are not alive per say.... but they get into cells and use living cells to reproduce
7 0
3 years ago
Read 2 more answers
Every 3 bases (a codon) in the RNA codes for 1 amino acid.
Oduvanchick [21]

Answer:

Lysine

Leucine

Serine

Glutamine

3 0
3 years ago
How to clean every types of pollutlon? PLEASE WITH LONG ANSWER
PolarNik [594]

Answer:

Properly dispose of hazardous household items. ...

Reduce or eliminate use of fertilizers and chemical herbicides and pesticides. ...

Make an appointment to service your septic system. ...

Landscape with native plants. ...

Eliminate bare spots in your yard. ...

Make a rain garden.

Explanation:

Does it work

4 0
2 years ago
Read 2 more answers
Please HELP!!!!!!!
Usimov [2.4K]

Answer:

C

Explanation:

Glucose is with engergy.  Oxygen would be the food.  Amino Acid helps with healing the cells.  

8 0
2 years ago
Other questions:
  • In binomial nomenclature, the genus functions as a(n) , and the species functions as a(n) .
    5·1 answer
  • A change that increases an organism's chances of survival is called a(n) _____.
    7·1 answer
  • Explain why too much coffee might increase your heart rate.
    10·2 answers
  • The time required for one complete cycle of binary fission is known as
    11·1 answer
  • Choose the list that correctly ranks metabolic rates per gram of body mass, from lowest to highest. view available hint(s) choos
    5·1 answer
  • Which of the following would best represent the electrical plug for the coffee maker model?
    9·2 answers
  • Given that the cytoplasmic membrane has a fluid dynamic nature, with phospholipids and proteins able to move about within the bi
    13·1 answer
  • 2) please fill in the blanks with the following options.
    13·1 answer
  • In meiosis, how does prophase i differ from prophase ii?.
    11·1 answer
  • Diffusion does not require any energy.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!