1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
4 years ago
7

After the DNA is copied (DNA replication), two sister chromatids are held together by

Biology
1 answer:
Zanzabum4 years ago
3 0
As I remembered, two sister chromatids are held together by a centromere..sorry if wrong
You might be interested in
A person's views on origins may be greatly influenced by embracing a particular taxonomic system. true or false?
tigry1 [53]
True because they are used to this system

7 0
4 years ago
Which kingdom do you think has the most “new” discoveries each year?
Rufina [12.5K]
Domain because it is the most broad of all kingdoms and doesn’t have specific classifications
5 0
3 years ago
Yo can someone help me out
Ivenika [448]

Answer:

i would say c

Explanation:

3 0
3 years ago
Read 2 more answers
Which of the following is the fusion occurring in our sun?
enyata [817]

Answer:

a proton fusion

Explanation:

google

6 0
3 years ago
The_______
Irina-Kira [14]

Answer:

Messianic secret

Explanation:

The Messianic secret is a theme in the Gospel of Mark that portrays the disciples and others as recognizing Jesus' identity as the Messiah. Jesus directed them not to tell anyone else.

Hope this helps!

pls mark brainliest :)

4 0
3 years ago
Other questions:
  • In the past 100 years the average temperature in the united states has increased by
    12·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • ]An igneous rock interacts with wind and water over a long period of time. Which of these is most likely formed as a result of t
    9·2 answers
  • In which mitotic phase are the sister chromatids separated and pulled to opposite poles? see section 12.2 ( page 258) . in which
    7·1 answer
  • Forensic investigators find a widespread dispersal pattern of elongated bloodstains on a wall with a void at the point of origin
    5·1 answer
  • HELP PLZ
    10·1 answer
  • Which is a greenhouse gas *
    5·2 answers
  • Explain why the suspension of isolated chloroplasts became alkaline when illuminated?​
    12·1 answer
  • Which fossil fuel contributes 13 percent of the electricity in the United States?
    5·2 answers
  • PLS HELP ME PLSSSSSSSS
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!