1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepan [7]
2 years ago
8

Tallness (T) in snapdragons is dominant to dwarfness (t), and red (R) flower color is dominant to white (r). The heterozygous co

ndition results in pink (Rr) flower color. If snapdragons are heterozygous for height as well as for flower color, a mating between them will result in what ratio?A) 9:4:3B) 1:2:1C) 27:9:9:9:3:3:3:1D) 9:3:3:1E) 6:3:3:2:1:1

Biology
1 answer:
laila [671]2 years ago
7 0

Answer:

E. 6:3:3:2:1:1

Explanation:

Look at the attached picture to see the Punnett square for your problem.

The cross for this is snapdragons who are heterozygous for both traits so the cross would be:

<em>TtRr x TtRr</em>

As you can see in the image, you have the following genotype combinations with the corresponding phenotype combinations:

GENTOTYPE       PHENOTYPE            NUMBER

TTRR                    Tall - Red                        1

TtRR                     Tall - Red                        2

TTRr                     Tall - Pink                       2

TtRr                      Tall - Pink                       4

TTrr                      Tall - White                     1

Ttrr                       Tall - White                     2

ttRR                      Short - Red                     1  

ttRr                       Short - Pink                    2

ttrr                        Short - White                  1

The following phenotype combinations in summary would then be:

Tall - Pink:     6

Tall - Red:      3

Tall - White:   3

Short - Pink:   2

Short - White: 1

Short - Red:   1

So the ratio is 9:3:3:2:1:1

You might be interested in
Brown rabbits have the genotypes BB or Bb. White rabbits have the gene type bb. If two brown rabbits, with the genotypes seen in
Masteriza [31]

Answer:

the answer would probably be 75%

Explanation:

If you do a punnet square it will show the results.

5 0
2 years ago
Read 2 more answers
During binary fission, a bacteria cell grows in size because DNA and other organelles are _____. exchanged transferred duplicate
ExtremeBDS [4]
Binary fission is the process of a bacterial cell going from singular to double. Therefore the correct answer would be: "During binary fission, a bacteria cell grows in size because DNA and other organelles are duplicated."
7 0
2 years ago
Read 2 more answers
Which fact supports the following conclusion?
Mrac [35]

Answer:

hello i think b not completely sure

Explanation:

8 0
2 years ago
Read 2 more answers
Herbicides are being used to kill weeds in a nearby field. The plants absorb the herbicides from the soil. Which organelle in th
stiks02 [169]
The organelle in the plant that will most likely store the absorbed herbicide waste is the vacuole. Vacuoles act as storage bubbles in plant cells. They could store various materials such as food or nutrients to help the plant survive. It can also store waste materials to prevent them from contaminating the entire cell.
5 0
2 years ago
Read 2 more answers
Which foods would have the following nutrient test results? (results shown below)
aniked [119]

Answer:

The correct answer is - option c.

Explanation:

Benedict test is used to test the presence of reducing sugar in a sample. If the benedict solution turns in red or orange color it means there is a presence of glucose as it is a reducing sugar. So, this test result shows that there no reducing sugar in the sample as it is blue.

Lugol test is the test to see if the sample has starch in it or no by turning in to blue color, in this result, it is orange in color which suggests that there is no starch available.

A Biuret solution is used to test for the availability of protein in a particular sample, purple or pink color is the representation of the presence of protein. There is no protein as per result

Sudan red test is used to test the presence of TGA, lipids, or lipoproteins in a sample by reacting with it and turn in to red color. The absence of the lipids shows no change as it is shown in this test.

Thus, the correct answer among these options is - option C.

4 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The ripened ovaries of a flower produce fruitseedseggs.
    12·1 answer
  • carbon is removed from the atmosphere and put into food through photosynthesis respiration decomposition diffusion
    14·1 answer
  • A flowering yucca plant and a yucca moth have a relationship. The adult female moth lays eggs in the plant, and the young moths
    5·2 answers
  • PLEASE HELP ILL GIVE BRAINLIST !!
    6·1 answer
  • Which 3 of the following are the main ideas of the Cell Theory?
    11·1 answer
  • Why do living things go to great lengths to increase<br> their chances of reproduction?
    6·1 answer
  • Describe the different types of traits that exist.What factors can affect these traits?
    12·1 answer
  • What is a bad consequence of extensive use of fertilizer? *
    8·1 answer
  • Two brothers have thick hair that grows over their faces and most of their bodies.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!