Where do scientists obtain adult stem cells? saliva pancreas skin bone marrow

1 answer:

6 0

<span> Embryonic stem cell research is kind of a dead area now since there is no way to control the differentiation. Most research is being done on adult stem cells to help map and control the differentiation process.

Stem-cells from aborted fetuses - The government doesn't sponsor this, if it is done it is by private companies not located in the USA. You could try researching umbilical cord stem cells to be somewhere near your topic. They come from the afterbirth of normal deliveries.

You could do a much easier report by covering cloning of mice through stem-cell technology. It is happening and helping scientists understand diseases. </span>

You might be interested in

Identify the substance.

REY [17]

Answer:

Nucleic acid

Explanation:

Lipid, carbohydrate, proteins are large insolubles that are broken down by enzymes, whereas hemoglobin is on the inside of red blood cells.

Hope this helps :)

4 0

3 years ago

Which of the following are found in both DNA and RNA?

makvit [3.9K]

Answer: phosphate groups, guanine, and cytosine

Explanation:

6 0

3 years ago

Knowing the half-life of carbon-14 enables scientists to<br><br> Plzz help ASAP

kotykmax [81]

Answer:

Calculate the age of an object by finding how much carbon-14 remains in the sample

5 0

3 years ago

What process describes the transfer of heat through matter by molecular activity?

weeeeeb [17]

Answer: Option (a) is the correct answer.

Explanation:

Conduction is defined as the process in which there is transfer of heat through the material of substance due to the difference in temperature of adjoining regions.

For example, cooking omelet in a pan is a conduction process.

Thus, we can conclude that out of the given options conduction is the process which describes the transfer of heat through matter by molecular activity.

8 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago