Answer:
Nucleic acid
Explanation:
Lipid, carbohydrate, proteins are large insolubles that are broken down by enzymes, whereas hemoglobin is on the inside of red blood cells.
Hope this helps :)
Answer: phosphate groups, guanine, and cytosine
Explanation:
Answer:
Calculate the age of an object by finding how much carbon-14 remains in the sample
Answer: Option (a) is the correct answer.
Explanation:
Conduction is defined as the process in which there is transfer of heat through the material of substance due to the difference in temperature of adjoining regions.
For example, cooking omelet in a pan is a conduction process.
Thus, we can conclude that out of the given options conduction is the process which describes the transfer of heat through matter by molecular activity.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved