Answer:
Estrogen and progesterone are both involved in preparing the endometrium for embryo implantation. Estrogen helps to ensure conception by increasing the amount of secretory glands in the uterus. Estrogen also increases blood supply to the endometrium.
Progesterone is crucial for embryo implantation and maintenance of pregnancy. Progesterone also enlarges secretory glands that produce carbohydrates, proteins and mucin that are required for embryo nourishment before implantation. Progesterone stabilizes endometrial muscles to prevent them from contracting during pregnancy.
Explanation:
- Estrogen and progesterone are steroid hormones of the reproductive system. Estrogen helps in conception whereas progesterone maintains pregnancy.
- Estrogen is secreted during the follicular phase of the menstrual cycle that promotes the growth and maturation of follicles in the ovary.
- Estrogen also induces oestrous behavior in females.
- Secreted by the corpus luteum, progesterone is also a steroid hormone, responsible for implantation of the embryo in the uterus.
Answer: the correct answer is d. all of the above must happen for defecation to occur.
Explanation:
In response to the distention of the rectal wall, the receptors send sensory nerve impulses to the sacral spinal cord. Motor impulses from the cord travel along parasympathetic nerves back to the descending colon, sigmoid colon, rectum, and anus. The resulting contraction of the longitudinal rectal muscles shortens the rectum, thereby increasing the pressure within it. This then opens the internal sphincter.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The biodiversity would change over time through ecological succession. This can be done many ways. One way would be through a damaging event, such as a forest fire or flood. Then, a pioneer species would start growing. A pioneer species would then lead to increased biodiversity in both antibiotic and biotic factors, therefore strengthening the ecosystem even more.
I hope this helps!! Can I have Brainliest, please? :)
