1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
3 years ago
6

Summarize the nitrogen cycle and it’s importance of proteins and DNA

Biology
1 answer:
iren2701 [21]3 years ago
4 0

Answer:

Nitrogen cycle works through various stages like, nitrogen fixation, nitrification, assimilation, ammonification, denitrification etc. It is a building block for protein and DNA

Explanation:

Nitrogen is an element abundantly found in the atmosphere, also its building block for proteins as well as nucleic acid i.e. DNA formation. In nitrogen cycle , the nitrogen is being prepared from inert nitrogen.  The nitrogen cycle has several processes like nitrogen fixation, in this the inert nitrogen is being converted to organic nitrogen with the help of certain micro-organism.

Nitrification, plants cannot absorb directly nitrogen so bacteria help the plants to convert the nitrogen into ammonia form in this stage. Assimilation, another stage in which plants starts absorbing various forms of nitrogen from the soil.i.e. nitrate, nitrite and ammonium. Ammonification, here plants and animals have nitrogen in there body after death various microbes help in decomposition in this stage. Denitrification, in this stage the return back of nitrogen takes place.

You might be interested in
Describe two typical applications for each of the following types of microscope
Veseljchak [2.6K]
A.Transmission electron microscopes are a versatile tool for many fields, including medicine, biology, nanotechnology, metallurgy, forensics, electronics, material science, and much more. A biologist might use a TEM to look at the internal structure of a cell.

b. Industries including microelectronics, semiconductors, medical devices, general manufacturing, insurance and litigation support, and food processing, all use scanning electron microscopy as a way to examine the surface composition of components and products.

c.Brightfield Microscope is used in several fields, from basic biology to understanding cell structures in cell Biology, Microbiology, Bacteriology to visualizing parasitic organisms in Parasitology. Most of the specimens to viewed are stained using special staining to enable visualization.

d.A dissecting microscope is used to view three-dimensional objects and larger specimens, with a maximum magnification of 100x. This type of microscope might be used to study external features on an object or to examine structures not easily mounted onto flat slides.
5 0
3 years ago
What the function if animal cell divide without centrioles?
Vesna [10]

Answer:

spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division.

Explanation:

They play a role in mitosis of animal cells and plant cells are able to reproduce without them.

Research however has shown that mitosis can take place in animal cells after centrioles have been destroyed. ... In higher plants mitosis takes place perfectly satisfactorily with microtubules forming spindle fibres but without the help of centrioles.

Hope this helpse!! Brainliest?? Anyways have a great day my loves<3

6 0
3 years ago
Which component of the blood is part of the body’s immune system?
crimeas [40]

<em><u>Answer: Plasma.</u></em>

<u><em /></u>

<em><u>Explanation: Plasma is the liquid component of blood, in which the red blood cells, white blood cells, and platelets are suspended. It constitutes more than half of the blood's volume and consists mostly of water that contains dissolved salts (electrolytes) and proteins. The major protein in plasma is albumin.</u></em>

<u><em /></u>

8 0
3 years ago
Read 2 more answers
What does the operon model attempt to explain?
sergiy2304 [10]

Answer:

a. the coordinated control of gene expression in bacteria

Explanation:

An operon in bacteria is a collection/cluster of genes that are under the control of a single promoter. It includes 3 components: a promoter, the genes and an operator. The operator is where a repressor binds, and the promoter is where transcription begins.

Operons allow organisms to control the expression of multiple genes in response to environmental cues

7 0
3 years ago
Released energy can be lost to the environment in what form
Schach [20]
Released energy can be lost to the environment in heat form.
8 0
3 years ago
Other questions:
  • The variability in marine salinity between habitats does not impact the fish living there
    9·2 answers
  • Which of the following statements does NOT relate to the nitrogen cycle?
    10·1 answer
  • Does the size of a genome determine how much information it contains quizl;et
    7·1 answer
  • A barrier that allows some substances in while keeping other
    9·1 answer
  • Each heredity trait corresponds to ___ ?
    9·1 answer
  • ASAP PLEASE HELPPP NEWTON’S THIRD LAW<br><br> THANKKK YOUU &lt;33333 (SCIENCE)
    6·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The development of the cell theory involved ___________________________. A. different ideas from different scientists. B. the ef
    14·1 answer
  • The current theory of the structure of the plasma membrane is best described by the what model
    13·1 answer
  • 1. Which sentence about galaxies provides evidence of universe expansion that supports the Big Bang Theory?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!