1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
14

Why does the ring of fire exist

Biology
2 answers:
Maurinko [17]3 years ago
8 0

I have no idea- ask Johnny Cash I think he'll be able to answer your question

lora16 [44]3 years ago
6 0
Secret Behind Formation of Volcanic 'Ring of Fire' Found. A large chunk of Earth's earthquakes and volcanic eruptions occur in a narrow zone around the Pacific Ocean known as the "Ring of Fire." Scientists are only just beginning to understand why this tectonic explosivity is so confined.
You might be interested in
Place these in order
svetoff [14.1K]

Answer:

The correct order would be:

Water evaporates from a lake.

↓

Water vapor condenses to form clouds.

↓

Water falls as rain, snow, and sleet.

↓

Water flows down mountains and hills.

↓

Water joins streams or forms groundwater.

Water cycle refers to the cyclic movement of water in an environment. The water passes through various stages, namely:

evaporation and transpiration

condensation

precipitation

run off

Explanation:

4 0
3 years ago
Read 2 more answers
How might the DNA-RNA-protein pathway affect cellular differentiation?
Gekata [30.6K]

Answer:

For example, cells in the interior of the body may be signaled by genes to become either muscle or connective tissues, while other cells on the exterior of the body will be signaled to become epithelial cells.

Explanation:

7 0
3 years ago
Read 2 more answers
The product(s) of the Calvin cycle is (are) Your answer: A) ATP and NADPH. B) glucose and oxygen. C) just glucose. D) ATP and gl
Sidana [21]
It’s Glucose and ATP
6 0
3 years ago
During energy conversion some energy is always lost as
fenix001 [56]
Some energy is always lost as heat

hope that helps! :))
7 0
3 years ago
Read 2 more answers
the two sources of information used to direct the expression of genes durning various stages of development are​
yan [13]

The two sources of information used to direct the expression of genes during various stages of development are​ Transcription and Translation.

<h3><u>Explanation:</u></h3>

Both of them combined is called gene expression.Transcription is the process of sharing information stored in a DNA to RNA. The process of translation is carried out in cytoplasm. Here, the mRNA, in which stands for messenger, send messages to a more complex and specialized molecule called the ribosome. The sequence present on the mRNA base is read by the ribosome.

Transcription takes place in nucleus and translation takes place in Cytoplasam. The products of transcription are mRNA, tRNA, rRNA. The products of translation are Proteins.

5 0
3 years ago
Other questions:
  • In the real world, many factors determine the numbers of organisms in any one population. Yet a "Superfly" population with unlim
    10·1 answer
  • A mutation in human atpase 6 (which corresponds to
    8·1 answer
  • What does human reproduction usually involves
    12·2 answers
  • What organ releases glucose to help maintain normal blood glucose levels?
    5·1 answer
  • Make an argument. Should children who are not vaccinated be allowed to attend school? Justify your answer.
    6·2 answers
  • Which two organ systems regulate homeostasis in our bodies?
    14·1 answer
  • Which region of the visible spectrum is not absorbed well by chlorophyll?
    15·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Write down the various adaptations to the environment that allow living things to survive in their environment and how these mec
    10·1 answer
  • Define nutrient and thermal pollution.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!