1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
4 years ago
8

What are the answers too 8th grade sep 3

Biology
1 answer:
damaskus [11]4 years ago
5 0

Answer:

what........................

You might be interested in
Compare and contrast radiant energy and sound energy
dangina [55]

Answer:

i

Explanation:

3 0
3 years ago
What is the name of the makeup of an organism's DNA, the collection of genes inherited from its parents?
dolphi86 [110]

Answer:

The correct answer choice is D. traits.

8 0
3 years ago
Read 2 more answers
Which biome has lost 99% of its natural habitat due to farming and ranching?
olga nikolaevna [1]

Answer:

D. tropical rain forest

Explanation:

deforestation for more farmland

pls mark as brainliest

hope this helps

4 0
3 years ago
Chromosomes with one arm very small and other very long called​
lina2011 [118]

Answer:

Acrocentric

Explanation:

hope this is right

7 0
3 years ago
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
Other questions:
  • ________, which is released from the pituitary gland, can potentially increase the height and weight of an individual to giganti
    5·1 answer
  • Woodcutting is done along the grain, whereas ____________ is done across the grain.
    12·1 answer
  • What are inactive forms of vitamins that are activated once in the body?
    14·1 answer
  • You keep stirring sugar into a glass of water until sugar crystals begin settling at the bottom. The solution is now _____.
    14·2 answers
  • Is it true that hydrogen bonds hold two strands of DNA together by forming between nitrogen bases
    14·1 answer
  • Applying the principles of binomial nomenclature, provide the scientific name of a Chilean flamingo?
    14·1 answer
  • Do lysosomes contain chromosomes ?
    6·2 answers
  • How does the egg of a flower become fertilized? 1 answer, not multiple choice.
    15·2 answers
  • Humans and chimpanzees share roughly how much DNA?
    8·2 answers
  • Name 4 examples of proteins.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!