I think it might be C I am not 100% sure though
Answer:
1 and 3
Explanation:
If you look at it the same things they have are
Phylum - Chlordata
Class - Mammalim
Order - Carnirvora
Family - Felidae
Genus - Felis
(sorry if i spelt something wrong, i cant really read it that well)
E-cool is a bacterium that occurs naturally in the intestines of people and animals
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
<span>The first response is correct. All these proteins are synthesized by ribosomes, and if you mean ribosomes bound to the ER, then at least ER Protein, INSULIN, and LYSOSOMAL ENZYME are correct.</span>
