1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew11 [14]
3 years ago
10

recall how Alfred Russel Wallace's theory compared to Darwin's theory of evolution by natural selection.

Biology
1 answer:
matrenka [14]3 years ago
5 0
If people were to be asked who developed the natural selection theory, almost always, Charles Darwin would be the name associated with it. But, Alfred Wallace is also the co-author or co-discoverer of the theory of evolution by natural selection. He was a naturalist that collected several species of plants and animals for experimental purposes. Both men actually published a joint paper arguing the theory of evolution and natural selection. But eventually Wallace faded when Darwin wrote the book the Origin of the Species. 
You might be interested in
Fermentation is the pathway used in the_____of oxygen
OverLord2011 [107]

Answer:

hello!

Explanation:

Fermentation is another anaerobic (non-oxygen-requiring) pathway for breaking down glucose, one that's performed by many types of organisms and cells. In fermentation, the only energy extraction pathway is glycolysis, with one or two extra reactions tacked on at the end.

5 0
3 years ago
To which anatomical location does the crani refer?
Sliva [168]
Hmm due to some thinking and having some knowledge of the body. I believe the crani refers to the skull. Crani could be considered short for cranium which refers to the skull. I hope that this helps!
6 0
3 years ago
The process of evolution involves changes in the genetic makeup of a population over a period of time. Sexual reproduction enhan
Anika [276]
The answer would have to be A
6 0
3 years ago
Read 2 more answers
1. What classification of pest has an exoskeleton, two body parts, and eight legs?
azamat

The correct answer is an Arachnid.

6 0
3 years ago
Read 2 more answers
List the 8 elements of weather that are observed for making weather forecasts
NemiM [27]
Temperature, precipitation, wind direction, wind speed, clouds (types and altitudes), atmospheric pressure, humidity, and visibility. It really depends on what you're forecasting but most of the time forecasters look for high/low-pressure systems in weather models and behavior of various winds at levels such as jet stream.
4 0
3 years ago
Other questions:
  • I need help, I am asking this here and I know this is not something you would post on brainly but I don't know who to ask. I don
    10·2 answers
  • What did Walter Sutton discover about the relationship between alleys and chromosomes?
    10·1 answer
  • What does a cytoplasm do?
    11·2 answers
  • You have noted an increase in cancer rates among a local harbor seal population. You also noted an increase in the release of to
    11·2 answers
  • Round seeds and yellow seed color are dominate to wrinkled seeds and green seed color. what is the probability of having offspri
    9·1 answer
  • Areas with relatively little wind.
    11·1 answer
  • What is a dendrite? A. It is a cell that sends signals to the central nervous system based on sensory input. B. It is the part o
    9·2 answers
  • What is plastic made of?​
    6·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • ______is an example of organisms contributing to air pollution.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!