1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
4 years ago
13

Which of the following biogeochemical cycles is used in cell formation and storage compounds in all organisms? Carbon cycle Hydr

ologic cycle Nitrogen cycle Phosphorus cycle
Biology
1 answer:
Andrei [34K]4 years ago
8 0
Carbon cycle is the answer
You might be interested in
How can inherited traits be controlled by one or more genes?
Illusion [34]
Multiple<span> allele </span>inheritances<span> are </span>traits controlled<span> by </span>more<span> than 2 alleles (ex: pigeons having 3 alleles of </span>one gene<span> govern their feather colour). The polygenic </span>inheritance <span>pattern of a </span>trait controlled<span> by two or </span>more genes<span>.
Hope this helps:D
Have a great rest of a brainly day!

</span>
7 0
3 years ago
Which layer of the heart wall contracts and is composed primarily of cardiac muscle tissue?
MAXImum [283]

Answer:Myocardium

Explanation: Myocardium is the middle layer of the heart wall. It is also the muscle tissue of the heart.

Myocardium is the thickest layer of the heart wall. It is madeup of cardiac muscle cells. These muscle cells possess contracting capability like other muscle cells.

3 0
4 years ago
Many of the extracellular signal molecules that regulate inflammation are released locally at the site of infection. What form o
r-ruslan [8.4K]

Answer: Paracrine

Explanation:

Paracrine signaling is a form of cell signaling in which a cell produces a signal that induces changes in nearby cells, altering the behavior or differentiation of those cells. Molecules known as paracrine factors diffuse over relatively short distances (local action), unlike endocrine factors (hormones that travel considerable distances over the circulatory system), juxtacrine interactions, and autocrine signaling.

<u>Cells that produce paracrine factors secrete them into their immediate extracellular environment. </u>These factors then travel to nearby cells where the gradient of the factor received determines the outcome. However, the exact distance a paracrine factor can travel is not known with certainty. Paracrine signaling is a form of cell signaling in which a cell produces a signal that induces changes in nearby cells, altering the behavior or differentiation of those cells. <u>Molecules known as paracrine factors diffuse over relatively short distances</u>, unlike endocrine factors (hormones that travel considerable distances over the circulatory system), juxtacrine interactions, and autocrine signaling.

Cells that produce paracrine factors secrete them into their immediate extracellular environment. These factors then travel to nearby cells where the gradient of the factor received determines the outcome. However, the exact distance a paracrine factor can travel is not known with certainty.

In the case of infection, cells of the innate immune system secrete different cytokines into their immediate extracellular environment that attract other immune system cells such as neutrophils and lymphocytes, to fight the infection.

6 0
3 years ago
Which process occurred when water droplets formed on the grass
Brrunno [24]

Answer:

condensation

Explanation:

because water is collected as droplets on a cold surface when humid air gets in contact with it

8 0
4 years ago
Read the sentence. Fill in the blank with the correct answer. Type answer in all lower-case letters.
insens350 [35]

Answer:

One astronomical unit is the approximate mean distance between the Earth and sun. It's about 93 million miles (150 million km), or 8 light-minutes. Enjoying ...

Explanation:

Image result for he distance between the Earth and the sun is about 93 million miles. To reduce the difficulties of dealing with the large numbers of these distances scientists have designated the distance from the Earth to the sun as one (blank) or AU aphelion Half a year after perihelion, Earth reaches its farthest distance from the star, which is called aphelion. At that moment, the planet is approximately 94.5 million miles (152.1 million km) from the sun. Aphelion occurs in early July. Perihelion and aphelion average out to about 93 million miles (150 million km).

5 0
2 years ago
Other questions:
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • Which other process that is important in the recycling of carbon should be added to the list? A combustion B denitrification C e
    10·1 answer
  • Which term describes this example? A rabbit's cells have two sex chromosomes that are different.
    13·2 answers
  • The place where a neuron transfers an impulse to another cell or neuron is the
    8·2 answers
  • What is the geological time scale based on?
    12·2 answers
  • Which action causes breakers​
    12·1 answer
  • Which of the following describes what might happen if the septum in the heart ruptured?
    11·2 answers
  • How many ATP can be formed from one glucose molecule during aerobic respiration?
    11·1 answer
  • Which tissue is found in papaya stem?
    13·2 answers
  • Short note of all disease of<br>Bee farming<br>​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!