1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ugo [173]
3 years ago
9

The diagram illustrates the water cycle. Which process occurs at location

Biology
1 answer:
Snowcat [4.5K]3 years ago
3 0

Answer:

Explanation:which location and also send the diagram, but there some processes like evaporation, condensation etc.

You might be interested in
A common theory for the origin of the
Sergeeva-Olga [200]

Answer:

yes.

Explanation:

because the figure represents a lot more similarities than differences

8 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
What is the usefulness of<br> categorizing Earth's history<br> into the geologic time scale?
Galina-37 [17]
Answer-
Found this quizlet with the answer hope it helped

8 0
3 years ago
If a color blind man marries a woman who is homozygous for normal vision. it is possible that one of their sons could be color b
Margarita [4]
The answer is a.True
8 0
3 years ago
If all living things are related then where did all their differences come from?
stiks02 [169]

Answer:

<em>Hox </em>Gene

Explanation:

First, you're question is very vital, there are many ways in classifying along with identifying all living organisms that includes; morphological analysis, molecular systematics (studying the similarities and differences of the genetic data such in the sequences of DNA, RNA, and rRNA ), homology, cladistics, etc. based on phylogenetic tree, which the study of the evolutionary among various species.

But through it said that all living organisms shared one common ancestor. However, what makes them different from one to another is the homeotic genes that called <em>Hox </em>Genes; which specify the fate of a particular segment or region of the body, meaning the number and arrangements of the<em> Hox</em> genes varies considerably among different types of animals.

For instance, Sponges have at least one homologous to<em> Hox</em> genes, also insects have nine or more <em>Hox </em>genes resulting in multiple <em>Hox </em>genes occur in a cluster in which the genes are close to each other along a chromosome. Therefore, increases in the number of<em> Hox</em> genes have been instrumental in the evolution of many animals species with greater complexity in body structure.

Overall, more <em>Hox</em> genes, more complexity in body structure resulting in the differences of their morphological structure.

Hope that answered your question!

7 0
3 years ago
Other questions:
  • Anton was by far the strongest swimmer,and he had no excuse to....?
    10·1 answer
  • Over the past 50 years, many researchers and farmers have been selectively breeding cattle to be more resistant to diseases. bas
    11·1 answer
  • 1 . An individual is a single living thing ? True or False ?
    5·1 answer
  • Describe the two stages of aerobic cellular respiration. Be sure to explain where in the cell each stage occurs.
    10·2 answers
  • During perspiration the entropy of the water
    13·1 answer
  • Biologists estimate how long ago species separated from a common ancestor using a technique called
    7·2 answers
  • Each cell of the muscles of a certain bug contains 28 chromosomes.
    13·1 answer
  • This is for kealani57 only thx :-)
    6·1 answer
  • The Canada lynx is a rare wildcat in Minnesota. The lynx has large "snowshoe' like feet that enables it to walk on top of deep,
    9·2 answers
  • One explanation for why our sense of smell and language are so disconnected is that
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!