1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
13

This is the set of rules by which information encoded in genetic material(DNA or mRNA sequences) is transferred into proteins

Biology
1 answer:
Ivanshal [37]3 years ago
5 0
The information encoded in genetic material(DNA or mRNA sequences) is transfersd into proteins is the codes tells to ribosoms how to make proteins.
You might be interested in
Which of the following situations best describes the use of a renewable resource?
Stells [14]
The best answer to the question stated above is <span>Building wooden furniture.

>Renewable Resource are </span><span>resource which are replaced naturally and can be used again.
</span>        Examples:<span>oxygen, fresh water, solar energy, timber.</span><span>
></span><span>Intensive cultivation of farmland that exhausts soil nutrients. Is an example of human acts which led to the depletion of renewable resource.

</span>
7 0
3 years ago
A temperatura dos corpos que tocamos determina as nossas sensações de quente e frio. Um corpo
Luba_88 [7]
The answer is c i think
3 0
3 years ago
Help me please please
disa [49]

Answer: I think it id b  But im not positive

4 0
3 years ago
Read 2 more answers
The human genome consist of about ____ chemical letters
Olegator [25]

I believe that it consists of about 3 billion letters/base pairs

5 0
3 years ago
Read 2 more answers
If a sample of rock is determined to be approximately 28,000 years old, apporximately what percent of the sample is still carbon
levacccp [35]
Uhhh 34% I think hope I help
3 0
3 years ago
Other questions:
  • What impact would the melting of the greenland glacier have on sea level
    6·1 answer
  • Newton's law of gravitation states that two masses will
    13·1 answer
  • An animal dies and falls into a river. Over time sand, rock, and other material settle on top of the animal remains, completely
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What happens to an enzyme’s structure as it exceeds the typical human body temperature?
    8·1 answer
  • Use words and diagrams to summarize the steps of replication, in order, in the boxes below
    15·1 answer
  • Which of the following is not a similarity between green algae and plants
    11·1 answer
  • Describe the feature of cell mbrane​
    10·1 answer
  • If Hh represents two alleles, what percentage of gametes produced will have the H allele?
    12·1 answer
  • Please write a paragraph including feelings and questions after reading this writing, include your understanding reflection. I a
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!