1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lapo4ka [179]
4 years ago
6

Question 18

Biology
2 answers:
pychu [463]4 years ago
7 0

Answer:

The change of surface area does not affect the speed of dissolving.  Hence the correct answer is option D.

Explanation:

Temperature has an effect on dissolving speed of the solute. If the temperature is raised high then dissolving rate becomes high and if the temperature is low the dissolving speed become slow. Steering also helps in increasing the dissolving speed of the solute.

Insulated container also allows to increase the temperature of dissolving the solute into the solvent. But the surface area is only a phenomenon which does not affect the rate of dissolving of a solute. Therefore, we can see that surface area has no effect on the dissolving speed.

cupoosta [38]4 years ago
3 0

Answer:

Insulated container

Explanation:

The insulated container, keeps aislated  what it holds. It´s purpose is to preserve, and avoid in some cases temperature change. This type of containers also are helpful when you need to transport or storage sensitive materials.

You might be interested in
Which of the following most likely supports the most sustainable ecosystem?
Anuta_ua [19.1K]

Answer:

The habitat with the greatest variety of living things.

8 0
3 years ago
Read 2 more answers
Some cancer-fighting drugs disrupt the cell cycle by preventing the formation
ololo11 [35]

I think during mitosis. Cancer fighting cells disrupt during the time when cells are splitting.

8 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Which micro-organisms are used to make bread soft and fluffy? Briefly describe how this happens.
Stells [14]

Answer:

Yeast is used to make the bread soft and fluffy . Yeast cells thrive on simple sugars . As the sugars are metabolized , Carbon dioxide and alcohol are released into the bread dough making it rise . So the bread becomes soft and fluffy. The baker made great bread.

Explanation:

8 0
3 years ago
Part A. Classity each as a carbohydrate, protein, lipid, or nucleic acid.
Harman [31]

you got this i believe in you

4 0
3 years ago
Other questions:
  • A galaxy is a system of celestial bodies, such as stars, planets, several solar systems, and interstellar gas and dust. Our sola
    9·2 answers
  • If there are three nucleotides coding for each amino acid and there are 20 amino acids, are there just 20 specific codons? if no
    5·1 answer
  • What is an electron orbit (energy level) ?
    15·1 answer
  • Cells go through a repeating cycle of events in growth regions such as plant root tips and animal embryos.
    10·1 answer
  • Which one of the codons below would stop the translation of mRNA by ribosomal subunits?
    15·1 answer
  • Both klebsiella pneumoniae and streptococcus pneumoniae avoid phagocytosis by releasing a-b toxins that kill leukocytes.
    12·1 answer
  • What is heamoglobin​
    11·2 answers
  • The word medium is used in paragraph 4. Which of the following could be the definition of medium?
    9·1 answer
  • Explain what can happen over millions of years to the carbon compounds in organism that die and decompose?
    8·2 answers
  • All of the following is allowed in wilderness except
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!