Complete the graphic organizer to summarize exceptions to Mendels principles

Biology

1 answer:

Butoxors [25]3 years ago

5 0

Answer:

Exceptions to Mendel's principles:

Does exceptions mean that Mendel was "wrong"? The answer is "NO". It means that we know more today about diseases, genes, and heredity than compared to what he expalined 150 years ago. Here I have summerized the exceptions with examples:

Incomplete dominance: When an organism is heterozygous for a trait and both genes are expressed but not completely.

Example: SnapDragon Flowers

Codominance: When 2 different alleles are present and both alleles are expressed.

Example: Black Feathers + Whites feathers --> Black and white speckled feathers

Multiple alleles: Three or more alternative forms of a gene (alleles) that can occupy the same locus.

Example: Bloodtype

Polygenic traits: more than one gene controls a particular phenotype

Example: human height, Hair color, weight, and eye, hair and skin color.

You might be interested in

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid

ruslelena [56]

Q1)

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)

DNA sequence with amino acids are given
5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows 
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
 Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.

Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’

This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr

Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro

7 0

3 years ago

HELPPP

Pavel [41]

the answer to your question is C. SS and Ss

7 0

3 years ago

What is a likely consequence of continued human population growth? A. More cropland B. Less erosion C. Less pollution D. More ra

omeli [17]

Answer:

The correct answer is option A More cropland

Explanation:

As the human population will increase, their demand for resources will also increase specifically for the three essentials namely air, water and food. In order to cater the need of increased food demand, more food is needed to be produced and thus more land is required. Apart from agricultural produce, even dairy farms, aquaculture or any other method of production of non vegetarian/other food sources, also require large amount of pasture land or crop land.

6 0

3 years ago

Excretion and the Kidneys The kidneys remove excess water, minerals, and other waste products from the blood. The cleansed blood

drek231 [11]

Each kidney has nearly a million individual processing units called capillaries is false as the units are called nephrons.

<h3>What are the nephrons?</h3>

Nephron, processing unit of the kidney, the shape that certainly produces urine withinside the procedure of doing away with waste and extra materials from the blood.

The nephrons paintings via a two-step procedure: the glomerulus filters your blood, and the tubule returns wanted materials for your blood and eliminates wastes. Each nephron has a glomerulus to clear out out your blood and a tubule that returns wanted materials for your blood and pulls out extra wastes.