Explain how a particular type of stress can cause the extinction of a species.

Which of the following was a function of the wetlands in Florida?

Mumz [18]

Controlling insects was one of the many things wetlands in florida did

7 0

3 years ago

Would a population with alot of generic variation or little generic variation be more likely to have individuals that can adapt

musickatia [10]

A population with a lot of genetic variation would likely have more phenotypic variation; therefore, such a population would more likely have individuals that can adapt to a changing environment. mutation can result in new alleles on chromosomes. ... this is the same effect that genetic drift can have on small populations.

8 0

3 years ago

Passive movement of fluids and bacteria from the interior of the small intestine through the space between cells of the intestin

Verdich [7]

<h2>Option (A) is Right Answer</h2>

Explanation:

(A) Tight junctions

<em>Tight junctions</em> are a narrow band in epithelial cells just <em>beneath their apical surface</em>
They comprise a system of <em>another protein and claudins</em>
Tight junctions provided two major functions such as <em>The ions through space between cells and They limit the section of particles</em>
Tight junctions may be provided fill in as weak pathways by framing specific systems for<em> little cations, anions, or water</em>
<em>Tight junctions are available just invertebrates</em>

7 0

3 years ago

I am doing a project in 7th grade for science to do one of these things

Sindrei [870]

I would personally choose the lets bake a model

3 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago