Genetic variety in organisms is created through C) Meiosis. mitosis is a stage of the cell cycle and asexual reproduction occurs between only one parent, so not much variety. Cell fission is a form of asexual reproduction in bacteria, archaea, and other unicellular organisms such as diatoms and protozoans.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
Read the explanation section.
Explanation:
We know, sand can't contain water because of it's nature. But mud can contain water. For preservation of an organisms, sometimes water is needed because many microbes needs water which helps to preserve the organisms. Along with this, mud has the nature of holding things for long time inside of it but sands doesn't have this.
As sand can't store water so that microbes don't do their work properly and that's why preservation get hampered.
But in mud, this problem isn't present.
THE ANSWER WOULD BE A because homeostasis is about maintaining something so something doesnt shut down example maintaining body temperature.
Oxygen bubbles will form if that is the case. The catalase makes the hydrogen peroxide break down.
Hope that helped.
