A) DNA fulfils all three conditions:
<span>(1) copy itself precisely - in the process of replication, DNA copies itself and two molecules of DNA are formed. This process is very precise thanks to the great number of proteins involved in these process that prevents error occurring and proteins that can fix the error if it occurs.
(2) be stable but able to be changed - DNA is very stable molecule otherwise, it cannot be a genetic material. However, its chains can separate in a short length so the translational machinery can attach to it and the process of transcription can occur. Also, in crossing over, during meiosis, </span>the exchange of genetic material occurs and chromosomes change a bit.<span>
(3) be complex enough to determine the organism’s phenotype - it contains a number of genes responsible for different traits. All of this results in the </span>organism’s phenotype.
B) DNA copies itself. <span>Meselson and Stahl conducted the experiments on DNA replication in which they used </span>E. coli<span> bacteria as a model system. After they labelled all bacteria's DNA with heavy 15N by using medium with heavy 15N, they switched bacteria to medium with light 14N. After several generations, all bacteria's DNA was labelled with light 14N. This experiment evidenced that the self-replication of DNA is semi-conservative process.</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.
Answer:
by conducting scientific experiment.
Explanation:
The effect of temperature on changes in flower color can be tested by performing scientific experiment. The temperature range will be independent variable and the variation in flower color will be dependent variable.
In this way the experiment will be done to see the result in order to prove the hypothesis.
