1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
2 years ago
7

In the United States, there has been an increase in the number of people infected by mosquito spread diseas that were previously

found only in countries south of the United States. Scientists want to investigate the cause of the increase in mosquito spread diseases. Scientists have predicted that the mosquitos carrying disease have moved further north as global temperatures have increased. Which questions would help investigate how the new mosquitoes are affecting the ecosystems of the United States ? Select all that apply. AHow much money has been spent to fight the diseases caused by these mosquitoes across the globe? B. How have the food webs in the United States changed as a result of the new mosquitoes? the natural predators to the mosquitoes also migrated north? What types of organisms are preying on the mosquitoes in their new habitats? E Are places in the United States using more pesticides to kill the new mosquitoes? If so, how are these pesticides impacting others in the ecosystems
Biology
2 answers:
Mila [183]2 years ago
7 0

Answer:

What types of organisms are preying on the mosquitoes in their new habitats?

Explanation:

I think it is all the answers except for What types of organisms are preying on the mosquitoes in their new habitats? this is because when a new species comes to an area it does not have anything to prey on it

bearhunter [10]2 years ago
3 0
I think the answer is how much money has been spent to fight the diseases caused by the mosquitos
You might be interested in
Convert 5.64 centimeters to millimeters
lawyer [7]

Answer:

56.4 millimeters

Explanation:

︎︎︎︎︎︎︎︎︎︎︎︎︎︎

4 0
3 years ago
Read 2 more answers
A. Do mammals such as humans have a cloaca?
blagie [28]

Most adult placental mammals have no remaining trace of the cloaca. Being placental animals, humans only have an embryonic cloaca, which is split up into separate tracts during the development of the urinary and reproductive organs.

8 0
3 years ago
What does pH measure?
kogti [31]

Answer: Answer below

Explanation: pH is a measure  of the acidity or alkalinity of a solution. What the pH scale measures is basically the concentration of hydrogen and hydroxyl atoms in a solution. So, the last option is the answer. Another thing to keep in mind is solutions with a pH under 7 are acidic, solutions with a pH of 7 are neutral, and solutions with a pH over 7 are alkaline or considered a base. I hope this helped! Good luck:)

7 0
2 years ago
​smoking increases ____ levels in the blood, thus increasing the possibility of unwanted clotting.
irina [24]

Answer:

Increases homocysteine levels

Explanation:

Homocysteine is an aminoacid that is resent in our blood already. This is mostly increased in our blood due to increased consumption of meat and other potential reasons, such as smoking.

High level of this aminoacid are linked to the development of heart diseases. This is because a high homocysteine level causes development of heart diseases along with other risks of renerl diseases.

Hope it helps!

6 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Other questions:
  • which plane velocity was greatest? Yeagers Bell x-1, The Concorde, SR71 blackbird, none they all traveled at the same speed.
    5·1 answer
  • 1. Eggs and sperm are examples of _______.
    7·2 answers
  • Suppose you have engineered a plasmid vector in order to produce a functional animal protein in
    11·1 answer
  • _____ is the best example of a sensitive period.
    13·1 answer
  • What steps should you follow to measure humidity with a psychrometer?
    11·1 answer
  • Which of the following is an important exception to the central dogma of molecular biology? a) Proteins are responsible for most
    10·1 answer
  • Why is liquid water so important for life ? <br><br> I need multiple reasons and why plz
    5·1 answer
  • Which plant is often used as a soil conditioner
    5·2 answers
  • Which of the following predictions about global climate change is directly related to an increase in the burning of fossil fuels
    15·1 answer
  • Genetic recombination plays a role in both maintenance and diversity within an organism. Explain how this balance is achieved an
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!