Most adult placental mammals have no remaining trace of the cloaca. Being placental animals, humans only have an embryonic cloaca, which is split up into separate tracts during the development of the urinary and reproductive organs.
Answer: Answer below
Explanation: pH is a measure of the acidity or alkalinity of a solution. What the pH scale measures is basically the concentration of hydrogen and hydroxyl atoms in a solution. So, the last option is the answer. Another thing to keep in mind is solutions with a pH under 7 are acidic, solutions with a pH of 7 are neutral, and solutions with a pH over 7 are alkaline or considered a base. I hope this helped! Good luck:)
Answer:
Increases homocysteine levels
Explanation:
Homocysteine is an aminoacid that is resent in our blood already. This is mostly increased in our blood due to increased consumption of meat and other potential reasons, such as smoking.
High level of this aminoacid are linked to the development of heart diseases. This is because a high homocysteine level causes development of heart diseases along with other risks of renerl diseases.
Hope it helps!
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.