1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
14

In the human body lysozyme is an enzyme that helps protect the body

Biology
1 answer:
krok68 [10]3 years ago
5 0

Answer:

Proteins

Explanation:

You might be interested in
Research on laboratory rats suggests that hunger is controlled by the __________.
Afina-wow [57]
The answer is b. hypothalamus.

Hypothalamus is a ventral part of diencephalon. It has many functions including control of hunger, thirst, body temperature, sleep, parenting behaviors, and circadian rhythms.
When an <span>animal </span>is not hungry, and it needs for food are satisfied, is called satiety. There is satiety center responsible for hunger. The center is located in hypothalamus.
7 0
3 years ago
Read 2 more answers
Suckling sends neural feedback to the hypothalamus which responds by releasing the hormone, oxytocin, from the posterior pituita
My name is Ann [436]
Prolactin is the hormone that stimulates milk production
5 0
3 years ago
Rose plant can reproduce by just cutting one of its long stems and stick it to the soil. This is a best example of what type of
Artemon [7]

Answer:

c

Explanation:

8 0
3 years ago
Which of the following is a primary function of the active site of an enzyme?
Fiesta28 [93]

The primary function of the active site of an enzyme is to catalyze the reaction associated with the enzyme (Option c). It is a fundamental structure in the enzyme.

<h3>What is the active site of an enzyme?</h3>

The active site of the enzyme is It is a fundamental structure in the enzyme that has catalytic activity.

The active site of the enzyme is a site that binds to the substrate to form the enzyme-substrate complex.

The formation of this complex leads to the generation of one or more products of a given chemical reaction.

Learn more about enzymes here:

brainly.com/question/1596855

3 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Which cell structures cause the outer surface of the rough endoplasmic reticulum to appear rough
    15·1 answer
  • Which theory best explains the present arrangement of continents, oceans, and landforms on Earth?
    5·2 answers
  • A fish fossil is found in a rock. A foot bone and tooth are found in an older layer of the same rock. What can scientists learn
    8·1 answer
  • I need help with this problem
    7·1 answer
  • I also don’t know how to do Punnett squares.
    6·1 answer
  • Which statement accurately describes a P wave? A. A P wave travels more slowly than an S wave. B. A P wave can travel through li
    8·2 answers
  • what helps scientists identity an organism through characteristics, A. species map B. family tree C.trait legend D.dichotomous k
    12·1 answer
  • Has volcanic eruption impacted the Earth’s wobble enough to impact climate changes in the UAE?
    11·1 answer
  • A bat is a mammal even though it flies in air. Why?​
    10·2 answers
  • A skeletal muscle is a composition of several components bundled one into the other. at which structural level in the muscle doe
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!