1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
3 years ago
15

What is the relationship between Endomembrane System, Insulin and Insulin Receptor, activation by phosphorylation, membrane-boun

d polyribosomes, and Glucose Transport Channels? Describe what you learned about the gut and nutrient absorption in the microscopy lab. Remember to include the relationships between the gut and nutrient absorption you learned from the Microscopy lab here in relation to the the other items listed.
Biology
1 answer:
mars1129 [50]3 years ago
7 0

Answer:

The relationship between endomembrane system, insulin and insulin receptor, activation by phosphorylation, membrane-bound polyribosomes, and glucose transport channels is the eukariotic cell, because within it, they work together with the organelles to modify, summarize and transport lipids and proteins from the gut and absorb nutrients.

Explanation:

The Endomembrane system varies from membranes and organelles, but basically, it is structured by the nuclear envelope and lysosomes, the plasma membrane and several cytoplasmic organelles, as the ER, the Golgi apparatus, secretory granules, vesicles, lysosomes, endosomes, and the endoplasmic reticulum all working together to transfer, modify and package lipids and proteins macromoecules to the eukaryotic cell, from one part of it  to another, and from in to the outside of it also.

The membrane bound polyribosomes are attached to the cell endoplasmic reticulum. The bound ribosomes, used within the cell membrane or expelled from the cell by exocytosis, will produce insulin and they will become membrane bound to control the intake, protein modifications, fusion lipids and sugar breakdown. The insulin is a membrane bound polyribosomes protein synthesized in the ER, which travels along the endomembrane system. This hormone controls glucose and lipid metabolism  or energy function, if glucose level is high, insulin synthesis is activated.  

Synthesized and traveling through the endomembrane system, the insulin gets to its receptor called tyrosine kinase and activates it, phosphorylating and recruiting different substrate adaptors.

 The brand new insulin polypeptide chains go directly into the endoplasmic reticulum by the ribosome and then transported to where they are needed as insulin regulates sugar uptake into adipose tissue and skeletal muscle through glucose transport channels or glucose transporters GLUT4 within vesicles, which are directed to the plasma membrane, this is also the gut and nutrient absorption.

You might be interested in
How many chromosomes does a child get from each parent?
Ira Lisetskai [31]
The offspring gets half of the required chromosomes from each parent. Human parents would give 23 chromosomes to their child as 23 + 23 = 46 chromosomes.
3 0
3 years ago
Read 2 more answers
Technology can have good and bad effects. What is a bad effect of spraying pesticides on crops with the use of airplanes?
Anastaziya [24]

The correct answer is option a, that is, It is sometimes sprayed too far from the crops.

The use of pesticides on crops may exhibit a significant threat to the environment, mainly in and nearby to water sources with sensitive ecosystems, sources area, public drinking water, residential areas, and recreational waters.  

Aircraft spray of pesticides takes place from a greater altitude than the ground-based equipment and on a major scale, both of these elements may enhance the threat of spray drift.  


6 0
3 years ago
Read 2 more answers
What are similarities of igneous and sedimentary rock
Sedaia [141]

Differences and similarities between igneous , metamorphic , and sedimentary rocks . sedimentary rocks are formed by weathered sediment using cementation or precipitation on Earth's surface . Metamorphic rocks are formed by changes of pressure and temperature within Earth's surface .

3 0
3 years ago
Read 2 more answers
What protects the sperm and then escorts them on the beginning part of thier jouney
vovangra [49]
Semen is the thick fluid that contains the sperm that is basic in nature, thus protecting it from the acidic nature of the vagina.
6 0
3 years ago
List 4 basic principles that the revised medical school curriculum was based upon
SVEN [57.7K]
Anatomy, Physiology are 2.
8 0
3 years ago
Other questions:
  • Green beetles survive because birds don't see them whereas brown beetles get detected this is an example of which mechanism of m
    6·1 answer
  • Please help<br>this is urgent​
    12·1 answer
  • Macromolecules containing hydrogen oxygen nitrogen carbon phosphorous
    13·1 answer
  • PLZ HELP ME D:<br> I will give u brainliest
    10·1 answer
  • What is the sciatic notch? How can it be used to determine gender?
    14·1 answer
  • I can rush, I can be still, I can be hot, I can be cold, I can be hard, I can slip
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Who discovered that white light is a spectrum of colours rays<br>​
    11·1 answer
  • Can someone please help me!!! In snapdragons, the allele for red flowers is represented as R, and the allele for white
    5·1 answer
  • The chemical symbols of elements.​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!