1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
12

The most dramatic temperature shifts in the past few decades have been

Biology
2 answers:
aivan3 [116]3 years ago
5 0
They have been in the Northern and Southern polar regions, and not within the inner part of earth, maybe due to there location
professor190 [17]3 years ago
5 0

Answer:

Option 1, . in Arctic areas such as Canada and Greenland

Explanation:

Please see the attachment

You might be interested in
Forensic anthropologists note that if we separate all of humanity into three groups (white, black, Asian), there are common trai
Talja [164]

Answer: C. In using a small number of "races," forensic anthropologists will incorrectly identify individuals from populations such as the Middle East or India, with the potential for false identification of the deceased.

Explanation:

Forensic anthropologists are the scientists who studies the morphological as well as the skeletal parts of the humans, animals, and birds both living or dead. These scientists can determine the age, sex and ethnic group or race in cases of impersonation as well as in cases of dead skeletal remains.

C. is the correct option, as it is a kind of bias. As the groups of humanity is wide in the form of white, black and Asian. Therefore, comparing the skeletal remains to small number of races can raise a valid criticism of the approach of skeletal examination and identification of deceased.

4 0
3 years ago
The 4th question please?
yulyashka [42]

An athlete or a person with some disease may vary in dietary needs.

<h3><u>Explanation</u>:</h3>

The diet is one of the most important part of a human life. The person gets energy, all the macro and micro nutrients from the food. They get to have all protective principles of food from diet. There's an average balanced diet formula which says that the amount of carbohydrate to fat protein in a diet should be 3:1:1.

But it varies according to person's daily need of energy. For an athlete, the amount of energy needed is much more. So the amount of fat and protein in diet should increase. For an obese person, fat and carbohydrate restricted diet should be used. For a person with renal failure, very low protein diet should be suggested.

5 0
3 years ago
Laboratory experiments, observational field studies, and model-building are all examples of different forms of scientific invest
Volgvan
Laboratory helps you identify things rather than the others using controlled variables 
3 0
3 years ago
Read 2 more answers
Explain why the process of mitosis is importance in cells
baherus [9]
Cells need mitosis in order to keep the supply of cells suitable for the human body to continue circulating with
6 0
3 years ago
The human body works to keep blood within a certain pH range an example of
borishaifa [10]

Homeostasis, aka your body maintaining life and the right amounts of stuff.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A client reports backache and abnormal increase in shoe size. The primary healthcare provider prescribes 100 g of oral glucose a
    12·1 answer
  • Which of the following soil samples is the most porous? Click on the picture until it shows the correct answer.
    8·2 answers
  • ___ all of the different types of plants and animals in an ecosystem​
    6·1 answer
  • (Giving brainliest if u helpp!! :) )
    5·2 answers
  • N
    14·1 answer
  • if random chromosome alignment already shuffles chromosomes around so the eggs and sperm get a good mix of some “mom” alleles an
    12·1 answer
  • Hurry im giving 50 point
    9·2 answers
  • Where can i find stemscopes answer keys?
    6·1 answer
  • Which section of the scientific manuscript presented in the case study on sandbar sharks defined young-of-year as sharks less th
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!