1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
5

Structures that are similar due to common ancestry are called:

Biology
1 answer:
ivann1987 [24]3 years ago
6 0
Analogous structures
You might be interested in
Describe cynodonts. What is their place in the evolution of mammals?
Brrunno [24]
<span>Mammals are advanced synapsids, animals distinguished by having extra openings in the skull behind the eyes; this opening gave the synapsids stronger jaw muscles and jaws (the jaw muscles were anchored to the skull opening) than previous animals. Synapsids include the mammals, and their ancestors, the pelycosaurs, therapsids, and cynodonts. Pelycosaurs (like Dimetrodon and Edaphosaurus) were early synapsids, they were mammal-like reptiles. Later synapsids include the therapsids and the cynodonts (with multicusped post-canine teeth; they lived from the late Permian through the Triassic period). The cynodonts led to the true mammals. Over time, the synapsid gait became more upright and tail length decreased</span>
6 0
3 years ago
Different ratios occur in crosses with single gene pairs or two gene pairs. What types of ratios are likely to occur in crosses
likoan [24]

Answer:

Genotype ratio: 1, 1:1, 1:2:1

Phenotype ratio: 1, 3:1

Explanation:

Single gene pair cross is also known as monohybrid cross. This means that only one gene usually with two alleles is observed and it express one trait.

For example, if we name the gene for a certain trait with A, the possible genotypes are AA (dominant homozygous), aa (recessive homozygous) and Aa (heterozygous). Possible crosses are:

P: AA  x  AA

F1 : all of them are AA

The same is with aa x aa (all of the offspring are with aa genotype)

P: AA  x  Aa

F1: AA Aa AA Aa  (genotype ratio 1:1) (phenotype ratio 3:1)

The same genotype ratio is  in aa x Aa (offspring will have aa Aa aa Aa-(genotype ratio 1:1) (phenotype ratio 1:1)

P: Aa x Aa

F1: AA Aa Aa aa (genotype ratio 1:2:1) (phenotype ratio 3:1)

P: AA x aa

F1: Aa Aa Aa Aa (1)

5 0
3 years ago
What is the primary function of chloroplasts? regulation of gas movement between the leaf and the environment carrying out photo
Nana76 [90]
The primary function of chloroplast is to carry out photosynthesis with the help of chlorophyll.
6 0
3 years ago
Why are the prefixes “mono” “di”, and “poly and the base “saccharide” good to use when describing the three types of carbohydrat
jolli1 [7]

Answer:

“Mono” denotes one, “di” denotes two, and “poly” denotes a large number. 

What is the significance of these words in defining the 

three forms of sugars? 

These terms are used because they depict how the 

molecule appears. 

The molecule's base unit is called a "saccharide."

Explanation:

-

7 0
3 years ago
While most bacteria are eliminated by antibiotics, some can possess mutations that are resistant to antibiotics, leading to more
Papessa [141]

Answer:

The trait must make the individual more fit to survive. True

Explanation:

Darwin proposed that genetic variations are present in natural populations. Some genetic traits become beneficial under the changed environmental conditions. The organisms with these genetic traits are able to survive and reproduce better than the organisms that lack them. This results in an increased proportion of the beneficial genetic traits in the population over generations as the individuals having those traits reproduce more.

The presence of antibiotic resistance is a beneficial genetic trait that allows bacteria to survive in the presence of antibiotics. Natural selection favors the bacterial having antibiotic resistance and increases their proportions in the population over generations.

3 0
3 years ago
Other questions:
  • One of the structures a cell uses to live grow and reproduce. Name this structure
    12·1 answer
  • How do the geosphere and atmosphere interact in the carbon cycle
    9·1 answer
  • Explain the significance of the threat that an invasive species brings to an ecosystem.
    15·2 answers
  • Explain how competition limits a population's growth.
    9·2 answers
  • EASY BRAINLIEST
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which organelle maintains homeostasis in the cell?
    8·1 answer
  • For IPC.
    13·1 answer
  • 2. A certain recessive, lethal gene is carried on the X chromosome. (Lethal genes are those that result in death.) A man marries
    14·1 answer
  • Compare the four types of cells animal, plant, protest, bacteria, what structures do they have in common
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!