1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wittaler [7]
4 years ago
13

PLZ NEED HELP ASAP !!!!

Biology
1 answer:
-BARSIC- [3]4 years ago
7 0

Answer:

(I will number the boxes from top to bottom)

1. DNA Polymerase

2. Topoisomerase

3. Okazaki Fragment

4. DNA Helicase

5. RNA Primase

I hope this helps! Let me know if you need further guidance.

You might be interested in
What does the notation Rr mean to geneticists? heterozygous alleles homozygous alleles dominant alleles recessive alleles
aksik [14]

Answer: Option A

Explanation:

The heterozygous allele can be defined as the condition in which the organism has two different alleles of the gene.

It is represented as Rr, means a capital letter and a small letter. This hows that the organism has one dominant gene and one recessive gene in it.

This dominant and recessive condition decides the genotype and phenotype of organism.

6 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
A plant is treated with a chemical that blocks the flow of electrons between photosystem II and photosystem I, such that protons
Sindrei [870]

Answer:

Reduce or stop the production of energy molecule i.e ATP

Explanation:

Proton is an essential ingredient to carry out light reactions successfully and the proton requirement is fulfilled through the proton gradient formed along the membrane. A chemical that blocks the flow of electrons thereby hindering the flow of proton will adversely affect the electron transport chain reactions thereby causing reduced/no conversion of ADP to ATP.  

6 0
3 years ago
I am doing a project in 7th grade for science to do one of these things
Sindrei [870]
I would personally choose the lets bake a model
3 0
4 years ago
Read 2 more answers
Immense characteristics ?
MakcuM [25]

Answer: Sense Of Humor. Good sense of humor is immensely attractive. End of …

Self-confidence. Confidence makes you shine in all fields of your life, but …

Kindness. Who wants to be around mean or rude people? Imagine going on a …

Passion. As the popular internet meme says, “People are prettiest when they …

Explanation: :)

7 0
3 years ago
Other questions:
  • The first organism in a food chain is a what type of organism?
    8·2 answers
  • clonal selection of lymphocytes leads to the development of which type of cells? a. effector cells and b cells b. t cells and me
    8·1 answer
  • In the DESERT BIOME, which of the following could be an example of mutualism?
    12·1 answer
  • If a person's parathyroids are responding properly to a drop in blood calcium, which of the following should result?a.Parathyroi
    13·1 answer
  • A sodium atom that has lost an electron comes near a chlorine atom that has gained an electron. What happens?
    14·1 answer
  • What is one reason that matter is able to move within earth?
    5·1 answer
  • The vitamin required specifically in carbohydrate metabolism is _______________. folate riboflavin thiamin niacin
    9·1 answer
  • If you were running an experiment to determine the color of light at which beans grew best, what would be the variable?
    14·1 answer
  • 5 sentences each help me please
    11·1 answer
  • What is the genotype of individual B in generation I?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!