1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hunter-Best [27]
3 years ago
13

11. A steel block has a volume of 0.08 m³ and a density of 7,840 kg/m³. What is the force of gravity acting on the block (the we

ight) in water?
Biology
1 answer:
andriy [413]3 years ago
3 0
Mass of block steel = 0.8*7.84= 6.272kg
Weight= 6.272kg*10N/kg= 62.72N
You might be interested in
Explain how concentration gradients across membranes are maintained
puteri [66]

Answer:  

The idea of concentrations and gradients within them is important when understanding the movement of substances across cell membranes. The more particles there are in a certain volume, the more concentrated those particles are. A solution with a low solute concentration has a high water concentration, and a high water potential.

8 0
3 years ago
Picture question? What is the answer please help
mina [271]

The answer is false there were only types the saurischians and the ornithischians.

5 0
3 years ago
on a planinetric map the blank is used to convert between the distance on the map the actual distance in real life
Makovka662 [10]

Answer: the map scale is used

Explanation:

4 0
3 years ago
A scientist is trying to classify a new organism. She observes that the organism is a microorganism. It is prokaryotic, and repr
katovenus [111]

Answer:

The correct answer is:

Archaea

Explanation:

took the test :)

7 0
3 years ago
How is muscle contraction reversed? A. Calcium binds to calmodulin and is quickly degraded to relieve calcium’s inhibition of tr
EastWind [94]

Answer:

When the stimulation of the motor neuron providing the impulse to the muscle fibers stops, the chemical reaction that causes the rearrangement of the muscle fibers' proteins is stopped.

Explanation:

This reverses the chemical processes in the muscle fibers and the muscle relaxes. hope this helps you :)

8 0
3 years ago
Other questions:
  • The single largest portion of the human genome consists of noncoding _______, some of which include ______. These are DNA segmen
    5·1 answer
  • A third species of kangaroo rat is introduced into the habitats of the two species from Question 5. If this third species is bio
    6·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is one type of white blood cell that participates in the specific immune response called? A. antigens B. antibodies C. macr
    12·2 answers
  • Which of the statements best describes the process of crossing over during meiosis? Haploid daughter cells trade chromosomes in
    5·1 answer
  • DNA Polymerase , I need the nickname and function and purpose
    7·1 answer
  • You have been assigned to care for Jim. He is 29 years old and has been diagnosed with Schizophrenia. Jim has been prescribed ch
    5·1 answer
  • What instruction or code is responsible for all the inherited traits of an organism
    11·1 answer
  • Which of the following is a principle of natural selection? A) Most organisms are infertile or produce nonviable offspring. B) M
    9·1 answer
  • A person who is interested in finding a cure for diabetes, in which the pancreas does not produce insulin, might pursue a career
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!